SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g29631

Feature Type:gene_model
Chromosome:Gm03
Start:37661096
stop:37662840
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g29631
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G41905AT Annotation by Michelle Graham. TAIR10: BEST Arabidopsis thaliana protein match is: arabinogalactan protein 23 (TAIR:AT3G57690.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | chr2:17495766-17495951 FORWARD LENGTH=61 SoyBaseE_val: 3.00E-11ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_D7LHZ7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7LHZ7_ARALL SoyBaseE_val: 7.00E-08ISS
UniRef100_UPI0002337AAFUniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337AAF related cluster n=1 Tax=unknown RepID=UPI0002337AAF SoyBaseE_val: 3.00E-30ISS

Expression Patterns of Glyma03g29631
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g29631 not represented in the dataset
Glyma03g29631 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g29631
ParalogEvidenceComments
Glyma19g32460 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g29631 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma03g29631
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g29631
>Glyma03g29631.1   sequence type=CDS   gene model=Glyma03g29631   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACGGAAATAAATCTAGGTCGTTTTGAACGATATATGTCAGACATCGGAGTCGACGATAAATCCAAGCCATGCAAGAGCCCCCCATTGTACCTCAGACCTGCAAGCAAAGACAATAAAAACAACACACACACACACACTTGTATCATCAGCACACCCGCGGGTCTCCAAAACAAGTCACACATTTTACTCGTCATGGACATGAAGAAGGTCACTTGCGCTCTTCTCATCGCCGCCGCCTCCATGAGTGCTGCAGTGGCTGCCGCCGAGGCTCCTGCCCCATCCCCCGGCCCTGGCCCAAGCAGCGGAGCCTCAGCTCCCCTTGTTGGCTCCTTGATTGGTGCCTCTGTATTGTCTTTCTTTGCCTTGTTCCAGTAA
Predicted protein sequences of Glyma03g29631
>Glyma03g29631.1   sequence type=predicted peptide   gene model=Glyma03g29631   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTEINLGRFERYMSDIGVDDKSKPCKSPPLYLRPASKDNKNNTHTHTCIISTPAGLQNKSHILLVMDMKKVTCALLIAAASMSAAVAAAEAPAPSPGPGPSSGASAPLVGSLIGASVLSFFALFQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo