Report for Sequence Feature Glyma03g28880
Feature Type: gene_model
Chromosome: Gm03
Start: 36814389
stop: 36825814
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma03g28880
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G10140 AT
Annotation by Michelle Graham. TAIR10: RECA homolog 3 | chr3:3134984-3137069 FORWARD LENGTH=389
SoyBase E_val: 2.00E-42 ISS
GO:0000002 GO-bp
Annotation by Michelle Graham. GO Biological Process: mitochondrial genome maintenance
SoyBase N/A ISS
GO:0006259 GO-bp
Annotation by Michelle Graham. GO Biological Process: DNA metabolic process
SoyBase N/A ISS
GO:0006281 GO-bp
Annotation by Michelle Graham. GO Biological Process: DNA repair
SoyBase N/A ISS
GO:0006310 GO-bp
Annotation by Michelle Graham. GO Biological Process: DNA recombination
SoyBase N/A ISS
GO:0009408 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to heat
SoyBase N/A ISS
GO:0009432 GO-bp
Annotation by Michelle Graham. GO Biological Process: SOS response
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003697 GO-mf
Annotation by Michelle Graham. GO Molecular Function: single-stranded DNA binding
SoyBase N/A ISS
GO:0005524 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATP binding
SoyBase N/A ISS
GO:0008094 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA-dependent ATPase activity
SoyBase N/A ISS
GO:0017111 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity
SoyBase N/A ISS
PTHR22942 Panther
RECA/RAD51/RADA DNA STRAND-PAIRING FAMILY MEMBER
JGI ISS
PTHR22942:SF1 Panther
DNA REPAIR PROTEIN RECA
JGI ISS
PF00154 PFAM
recA bacterial DNA recombination protein
JGI ISS
UniRef100_G7KSL4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: RecA n=1 Tax=Medicago truncatula RepID=G7KSL4_MEDTR
SoyBase E_val: 5.00E-60 ISS
UniRef100_I1JN96 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JN96_SOYBN
SoyBase E_val: 2.00E-151 ISS
Expression Patterns of Glyma03g28880
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma03g28880
Paralog Evidence Comments
Glyma19g31600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma03g28880 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
References for Glyma03g28880
Coding sequences of Glyma03g28880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma03g28880.1 sequence type=CDS gene model=Glyma03g28880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
AATGGAGGTAGACAAGTAATGACCAGGATTGGCATGAATGCCTGCTCTCTTTCTTCTGCAGCTGAAGCTTCAGATTTTGAATGTGATGTGACCCATGATGATGTCAAAGCAGCAGACAAAGATAATGCACTTTGCTTGGCTCTCTCACAGCTTAAGATTTTTGGTGTACGCCGTGCTCGTGTGATATCTATAGGCTCCTTGAAGCTTCATCTAGCTCTGGGAATTAGAGGATTACCAAAGGGTAGGATTGTGGAAATTTATGGACGAGATGCAGCTGGTAAGACTACAATTGCACTTCGAATTATTAAAGAAGCTCAAAAGCTTGGAGGATATTGTGCATATCTTGATGTGGAAAATGCATTGGACTTCTCACTTATGGAATCGATGGGCGTGGAGGGTGTTATGATCTGTGCTCAAGTGGTAAAAAATAAACTAGCACCCGCAGCAACGAAAAGGGCTGAACAGGGTATCAAGTTTGGAAGAGGGTTTTGCCATGAGTCAGATGTCTTAGATTTGGCTTGTGAACATGGAATCATTGTGAAACATGAGGGAAGCTACTTTATTGAAGGGAGCAGTTTGGATAGTAGAGAAGCAGCTGAACTATTTTTGGCTCAAAATGATGCAGTTTGTGACAAGTTG
Predicted protein sequences of Glyma03g28880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma03g28880.1 sequence type=predicted peptide gene model=Glyma03g28880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
NGGRQVMTRIGMNACSLSSAAEASDFECDVTHDDVKAADKDNALCLALSQLKIFGVRRARVISIGSLKLHLALGIRGLPKGRIVEIYGRDAAGKTTIALRIIKEAQKLGGYCAYLDVENALDFSLMESMGVEGVMICAQVVKNKLAPAATKRAEQGIKFGRGFCHESDVLDLACEHGIIVKHEGSYFIEGSSLDSREAAELFLAQNDAVCDKL