SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g28021): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g28021): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g28021

Feature Type:gene_model
Chromosome:Gm03
Start:35855639
stop:35856476
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g28021
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G67960AT Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 447 Blast hits to 428 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 190; Fungi - 133; Plants - 49; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). | chr1:25480808-25484176 REVERSE LENGTH=624 SoyBaseE_val: 1.00E-37ISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0010183GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube guidance SoyBaseN/AISS
GO:0035437GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of protein localization in endoplasmic reticulum SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005788GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum lumen SoyBaseN/AISS
PTHR13317Panther UNCHARACTERIZED JGI ISS
PTHR13317:SF4Panther gb def: hypothetical protein, similar to yeast yer140w [schizosaccharomyces pombe] JGI ISS
PF05346PFAM Eukaryotic membrane protein family JGI ISS
UniRef100_G7J478UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transmembrane anterior posterior transformation protein-like protein n=1 Tax=Medicago truncatula RepID=G7J478_MEDTR SoyBaseE_val: 3.00E-38ISS
UniRef100_UPI000233803EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233803E related cluster n=1 Tax=unknown RepID=UPI000233803E SoyBaseE_val: 6.00E-57ISS

Expression Patterns of Glyma03g28021
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g28021 not represented in the dataset
Glyma03g28021 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g28021 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g124800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g28021
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g28021
>Glyma03g28021.1   sequence type=CDS   gene model=Glyma03g28021   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTATTTCATTCAGCAGAAGAACTTGCAAGATGTCCCCTGAAAACAGAAATTATACTTGTTCATTCTTTTATCTTATTAGTTCAGGCAATCACTTTATCAGTCTGTATTGTTTCTCACTACAATGCTCTGCCAGCTTTGCTGGTGTCAAATAATTTTTCTGAGATCAAAAGCTATGTGTTTAAGGGATATAGTAAGGATAATGTTCACAGTATGGTGTACTCTGATTCCATAGAGAGATTCCACATCTCAGCACTTATCTTATTTGTTTTGACTCAAAATATTCTGAAGGCAGAAGGACCCTGGTTTGGAAGTTTTATCAGTAACATCTCTTGGTTTATCTATTTGAAATGGCTATAG
Predicted protein sequences of Glyma03g28021
>Glyma03g28021.1   sequence type=predicted peptide   gene model=Glyma03g28021   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLFHSAEELARCPLKTEIILVHSFILLVQAITLSVCIVSHYNALPALLVSNNFSEIKSYVFKGYSKDNVHSMVYSDSIERFHISALILFVLTQNILKAEGPWFGSFISNISWFIYLKWL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo