SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g27930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g27930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g27930

Feature Type:gene_model
Chromosome:Gm03
Start:35719339
stop:35721676
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11520AT Annotation by Michelle Graham. TAIR10: CYCLIN B1;3 | chr3:3625475-3627139 REVERSE LENGTH=414 SoyBaseE_val: 1.00E-116ISS
GO:0000079GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0000087GO-bp Annotation by Michelle Graham. GO Biological Process: M phase of mitotic cell cycle SoyBaseN/AISS
GO:0000280GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear division SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0007049GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0010440GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal lineage progression SoyBaseN/AISS
GO:0010583GO-bp Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone SoyBaseN/AISS
GO:0034968GO-bp Annotation by Michelle Graham. GO Biological Process: histone lysine methylation SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0051225GO-bp Annotation by Michelle Graham. GO Biological Process: spindle assembly SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016538GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase regulator activity SoyBaseN/AISS
GO:0019901GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase binding SoyBaseN/AISS
KOG0653 KOG Cyclin B and related kinase-activating proteins JGI ISS
PTHR10177Panther CYCLINS JGI ISS
PTHR10177:SF24Panther G2/MITOTIC-SPECIFIC CYCLIN B JGI ISS
PF00134PFAM Cyclin, N-terminal domain JGI ISS
PF02984PFAM Cyclin, C-terminal domain JGI ISS
UniRef100_I1JN23UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JN23_SOYBN SoyBaseE_val: 0ISS
UniRef100_P25011UniRef Annotation by Michelle Graham. Most informative UniRef hit: G2/mitotic-specific cyclin S13-6 n=1 Tax=Glycine max RepID=CCNB1_SOYBN SoyBaseE_val: 6.00E-177ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g27930 not represented in the dataset

Glyma03g27930 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g124000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g27930.2   sequence type=CDS   gene model=Glyma03g27930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCAAGACCCACGGTTCAACAACAAGCCAGAGCTTTGGTTATTCAACAATCTTTACAGAGCAAAAGGGTCTCTCTTGTTAAGAGTTTTGGTGCCAAACTACTTGCCACTGTGCAAGCACCAGCAGCTGCTGAAAACAACATGAAACAAGCATGTGCTAATGTGGCTGGAGCTCCTCCTGTTGCTAAAGGAGTTGCGCTGGCCAAAAGAGCGGTGGCCCCCAAACCGGGTCAGAAGAAAGTGACTGTAAAACCTAAGTCTGAGGAAAAAAAGGAAAAGAAATCATGCAGTCTTACTTCAGTATTCACAGCTCGAAGCAAGCCGAAGGATCAGATTCTTGACATCGATGCTTCTGATGTTGACAATGAACTTGCTGCTGTGGAGTATATTGATGACATTTACAAGTTCTATAAGCTTGTTGAGAACGAGAGCCACCCCCGTGACAACATAGACTCACAACCTGAGATAACTGAGAGGATGAGAGCTATACTAGTTGATTGGCTGATACAAGTCCAAACCAAGTTTGAACTTTCACTTGAGACCCTTTACTTGACAATCAATATAGTTGATTGGTTCCTGGCGGTTAAGAATGTTCCAAAGAGGGAACTGCAATTGGTTGGCATCAGTGCTGTGCAGATGGCAACCAAGTATGAAGAAATCTATCCCCCTCAGGTTCATAACTTTGTCTTCCTCTCAGGTAGGGCTTACACTCATGAACAGATACTGATTATGGAGAAAATCATACTGGCCAAGCTGGACTGGACTTTGACTGTGCCAATACCTTTGGTTTTCCTACTTCGTTTTATCAAGGCATCAGTCCCAGATCAGGAGTTGGAAAACATGGCTCATTTTCTGTCTGAGTTGGGATTGATGAATTATGCGACTGAAATGTATTGGCCATCAATGGTTGCTGCCTCAGCAGTCTTTGCAGCTAGATGCACTCTGAATAAGGCTCCCCTTTGGAATGAGACACTTAAGCTGCAGACAGGTTACTCACAAGAACAACTTATGTATATTATTGGTGTGCTTCCACTGCCCGCTGGGAACAAAAAGCTAAAAGTTGTGTACAGAAAGTATTCTGATCCTCAGAAAGGAGCTGTTGCTTTGCTCCCACCAGCTAAAAATCTGCTGCCTGAAGGTTCCTCTGCCTCCCAATAG

>Glyma03g27930.2   sequence type=predicted peptide   gene model=Glyma03g27930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASRPTVQQQARALVIQQSLQSKRVSLVKSFGAKLLATVQAPAAAENNMKQACANVAGAPPVAKGVALAKRAVAPKPGQKKVTVKPKSEEKKEKKSCSLTSVFTARSKPKDQILDIDASDVDNELAAVEYIDDIYKFYKLVENESHPRDNIDSQPEITERMRAILVDWLIQVQTKFELSLETLYLTINIVDWFLAVKNVPKRELQLVGISAVQMATKYEEIYPPQVHNFVFLSGRAYTHEQILIMEKIILAKLDWTLTVPIPLVFLLRFIKASVPDQELENMAHFLSELGLMNYATEMYWPSMVAASAVFAARCTLNKAPLWNETLKLQTGYSQEQLMYIIGVLPLPAGNKKLKVVYRKYSDPQKGAVALLPPAKNLLPEGSSASQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo