SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g27850

Feature Type:gene_model
Chromosome:Gm03
Start:35634153
stop:35637115
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g27850
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G56650AT Annotation by Michelle Graham. TAIR10: Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein | chr3:20984807-20985913 FORWARD LENGTH=262 SoyBaseE_val: 6.00E-128ISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009523GO-cc Annotation by Michelle Graham. GO Cellular Compartment: photosystem II SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009543GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid lumen SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009654GO-cc Annotation by Michelle Graham. GO Cellular Compartment: oxygen evolving complex SoyBaseN/AISS
GO:0019898GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extrinsic to membrane SoyBaseN/AISS
GO:0031977GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF01789PFAM PsbP JGI ISS
UniRef100_A2Q6H0UniRef Annotation by Michelle Graham. Most informative UniRef hit: PsbP domain-containing protein n=1 Tax=Medicago truncatula RepID=A2Q6H0_MEDTR SoyBaseE_val: 3.00E-144ISS
UniRef100_I1JN14UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JN14_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g27850
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g27850
ParalogEvidenceComments
Glyma19g30670 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g27850 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g123100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g27850
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g27850
>Glyma03g27850.1   sequence type=CDS   gene model=Glyma03g27850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAACCTTTGCATTCACTTCCTTGCTCCCACTTACAGTCTCATCACCATCTTCATCTTCCAAATTCTCAGCTTTTCATGCTATCAGAGCCTCATTAGATTCTGAGTATGTTGCCTCCCGACACACCCTTAGAAGGGAATTCTTGAAGGGTGTTGCTTTGATGCCTCTGCCACTTGTTGTGATGAGAGAACCACCCCCTTCACATGCTAGAGAAGTTGAGGTTGGCTCCTTCCTTCCACCCTCTCCCTCTGACCCTTCTTTCGTTCTCTTCAAGGCCACTCCCAAGGACACTCCAGCCCTTCGAGCAGGAAATGTGCAGCCATACAAGTTTATCCTCCCCCCGACTTGGAAACAGGCTCGTGTAGCAAATATATTATCTGGAAATTACTGCCAGCCTAAATGTGCAGAGCCCTGGGTGGAGGTTAAGTTTGAAGATGAAAAACAAGGAAAAGTTCAGGTTGTTGCTTCGCCTTTGATACGCCTTACCAACAAACCGAATGCATCAATTGAGGACATCGGGAGCCCAGAAAAACTGATTGCTTCTCTTGGGCCATTTGTCACTGGAAACACTTTGGATCCAGATGAGCTCCTTGAGACTTCTGTTGAAAAGATTGGCGATCAGACATACTACAAATACGTGCTCGAAACACCATATGCTCTCACAGGAACACACAATCTTGCAAAAGCAACAGCAAAGGGAAACACTGTTGTTTTGTTTGTGGTTAGTGCCAATGACAAGCAGTGGCAAACTTCTGAGGAGACTCTAAAGGCCGTGCTTAATTCCTTTGAAGTTTAG
Predicted protein sequences of Glyma03g27850
>Glyma03g27850.1   sequence type=predicted peptide   gene model=Glyma03g27850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTTFAFTSLLPLTVSSPSSSSKFSAFHAIRASLDSEYVASRHTLRREFLKGVALMPLPLVVMREPPPSHAREVEVGSFLPPSPSDPSFVLFKATPKDTPALRAGNVQPYKFILPPTWKQARVANILSGNYCQPKCAEPWVEVKFEDEKQGKVQVVASPLIRLTNKPNASIEDIGSPEKLIASLGPFVTGNTLDPDELLETSVEKIGDQTYYKYVLETPYALTGTHNLAKATAKGNTVVLFVVSANDKQWQTSEETLKAVLNSFEV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo