SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g27380

Feature Type:gene_model
Chromosome:Gm03
Start:35095225
stop:35098637
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g27380
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G56940AT Annotation by Michelle Graham. TAIR10: dicarboxylate diiron protein, putative (Crd1) | chr3:21076594-21078269 FORWARD LENGTH=409 SoyBaseE_val: 0ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0015994GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll metabolic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0019216GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of lipid metabolic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0031408GO-bp Annotation by Michelle Graham. GO Biological Process: oxylipin biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009706GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast inner membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0046872GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion binding SoyBaseN/AISS
GO:0046914GO-mf Annotation by Michelle Graham. GO Molecular Function: transition metal ion binding SoyBaseN/AISS
GO:0048529GO-mf Annotation by Michelle Graham. GO Molecular Function: magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase activity SoyBaseN/AISS
PF02915PFAM Rubrerythrin JGI ISS
UniRef100_B9SCF8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase, chloroplast, putative n=1 Tax=Ricinus communis RepID=B9SCF8_RICCO SoyBaseE_val: 0ISS
UniRef100_I1JMX7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JMX7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma03g27380
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g27380
ParalogEvidenceComments
Glyma19g30350 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g27380 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g119500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g27380
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g27380
>Glyma03g27380.1   sequence type=CDS   gene model=Glyma03g27380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTCCTCCTTAGTCCTCCTCAGCCTCAACTTCAACCTTTCTTCACTTCCCTTCACATGGCAGCTCTTGTGAAACCAATTTCCAATGTCACTCCCAAATTTGTCAGCAGCCCCAGAATGGGCTCATCACACTCCTCCAAATTCAGCACCATAATAAGAATGTCTGCCACTGCCACCCCACCACCATCCACCTCCACAAAGCCAGCAAGCAGCAAGAAGGGCAATATCAAGGAGACCCTCTTGACTCCAAGATTCTACACCACTGACTTTGATGAGATGGAGACACTCTTCAACACTGAGATCAACAAAAACCTCAACCAGGATGAGTTTGAGGCACTGCTCCAGGAGTTCAAGACTGACTACAACCAGACACACTTTGTCAGGAACAAGGAGTTCAAGGAAGCCGCTGACAAACTTGAGGGTCCCCTCAGACAGATCTTTGTGGAGTTCCTTGAGAGGTCCTGCACTGCTGAATTCTCTGGCTTCCTTCTCTACAAAGAGCTTGGAAGGAGGCTAAAGAAAACCAACCCTGTGGTGGCTGAGATTTTCTCACTGATGTCTAGGGATGAAGCCAGGCATGCTGGGTTTTTGAACAAGGGTTTATCTGATTTCAATTTGGCTCTGGACTTGGGTTTCTTGACCAAAGCTAGAAAATACACATTTTTCAAGCCAAAGTTTATCTTCTATGCTACATACTTGTCTGAGAAAATTGGGTACTGGAGATACATAACCATATACAGACATCTCAAGGCCAACCCTGAGTTTCAATGTTATCCCATTTTTAAGTACTTTGAGAACTGGTGCCAGGATGAGAACAGACATGGAGATTTCTTCTCTGCCCTGATGAAGGCACAGCCACAATTTCTAAATGACTGGAAGGCAAAGTTGTGGTCTCGATTCTTCTGTCTATCGGTTTATGTCACAATGTATCTCAATGATTGCCAACGTACAGCTTTCTACGAAGGCATTGGACTTAACACAAAAGAATTTGACATGCATGTCATTATCGAGACAAACCGCACAACTGCTCGGATTTTCCCAGCCGTTCTTGATGTTGAAAACCCAGAGTTCAAGCGGAAGTTGGACCGGATGGTGGAGATAAATGAGAAGCTTGTTGCTGTTGGTGAGAGCGATGACATAGCGGTGGTGAAGAACTTAAAGAGGATCCCACTGGTTGCTGCCTTGGTGTCTGAACTCTTGGCTACATATCTAATGCCTCCAATTGAGTCAGGGTCTGTAGATTTGGCAGAGTTTGAACCACAACTTGTGTACTAA
Predicted protein sequences of Glyma03g27380
>Glyma03g27380.1   sequence type=predicted peptide   gene model=Glyma03g27380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLLLSPPQPQLQPFFTSLHMAALVKPISNVTPKFVSSPRMGSSHSSKFSTIIRMSATATPPPSTSTKPASSKKGNIKETLLTPRFYTTDFDEMETLFNTEINKNLNQDEFEALLQEFKTDYNQTHFVRNKEFKEAADKLEGPLRQIFVEFLERSCTAEFSGFLLYKELGRRLKKTNPVVAEIFSLMSRDEARHAGFLNKGLSDFNLALDLGFLTKARKYTFFKPKFIFYATYLSEKIGYWRYITIYRHLKANPEFQCYPIFKYFENWCQDENRHGDFFSALMKAQPQFLNDWKAKLWSRFFCLSVYVTMYLNDCQRTAFYEGIGLNTKEFDMHVIIETNRTTARIFPAVLDVENPEFKRKLDRMVEINEKLVAVGESDDIAVVKNLKRIPLVAALVSELLATYLMPPIESGSVDLAEFEPQLVY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo