SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g26540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g26540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g26540

Feature Type:gene_model
Chromosome:Gm03
Start:34002285
stop:34003276
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G37930AT Annotation by Michelle Graham. TAIR10: serine transhydroxymethyltransferase 1 | chr4:17831891-17834742 REVERSE LENGTH=517 SoyBaseE_val: 6.00E-18ISS
GO:0006544GO-bp Annotation by Michelle Graham. GO Biological Process: glycine metabolic process SoyBaseN/AISS
GO:0006563GO-bp Annotation by Michelle Graham. GO Biological Process: L-serine metabolic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0019464GO-bp Annotation by Michelle Graham. GO Biological Process: glycine decarboxylation via glycine cleavage system SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005759GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial matrix SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004372GO-mf Annotation by Michelle Graham. GO Molecular Function: glycine hydroxymethyltransferase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008266GO-mf Annotation by Michelle Graham. GO Molecular Function: poly(U) RNA binding SoyBaseN/AISS
GO:0030170GO-mf Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding SoyBaseN/AISS
UniRef100_C6ZJY8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine hydroxymethyltransferase n=1 Tax=Glycine max RepID=C6ZJY8_SOYBN SoyBaseE_val: 2.00E-19ISS
UniRef100_I1JMR8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JMR8_SOYBN SoyBaseE_val: 1.00E-142ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g26540 not represented in the dataset

Glyma03g26540 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g112900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g26540.1   sequence type=CDS   gene model=Glyma03g26540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGGGGATCAAAAGTAAAGAGACTCCCAAAAAGCATCAGGCCTACGGAAAAGTTGCTTTTACGTGCTATGTGTGTGTGTGTGAGAGAGAAAATAGCCTTTGCCTGCTATGTGTGTGTAGTAAAGTGGAAAACCAGAGGCATGGCAGCAAGAAAAGAAAAGAAAAGTTTGCGAGGAAGGAAAACCAGGCAGCAAGAAAAGAAAAGAAAAGCTTGCGGGAAAGGAAAACCAGGCAGCAAAAAAAGAAAAGAAAAGCTTGCGGGGAAGGAAAACCAGAGGATAAATAAGAAGCAAAGCTTACCTGCGCGGGGAAGGAAACCAATGCGGCAATGGCGGCGCTTGCGGGAAGAAGAAGGAGAAGACACAGAACGACAGAGGTGTCCTCCTGTTCAACCGCGTCCGGTGACGGCGCCGGCGTCGGACACCGCGTCGCACCGGAGTCGTACGCGCATGGGAACAAAGATGAAGGACTTCTTGGCCACAATTGAGTTATCTTCTACCTTTCAATCGGAGATAGCAAAGCTCCGCCATCATGTTGAGGAGTATGCAAAACAATTTCCAACCATTGGTTTTGATAAAGCAACCATGAAGCACAAGAATTGA

>Glyma03g26540.1   sequence type=predicted peptide   gene model=Glyma03g26540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MWGSKVKRLPKSIRPTEKLLLRAMCVCVREKIAFACYVCVVKWKTRGMAARKEKKSLRGRKTRQQEKKRKACGKGKPGSKKRKEKLAGKENQRINKKQSLPARGRKPMRQWRRLREEEGEDTERQRCPPVQPRPVTAPASDTASHRSRTRMGTKMKDFLATIELSSTFQSEIAKLRHHVEEYAKQFPTIGFDKATMKHKN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo