SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g26285): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g26285): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g26285

Feature Type:gene_model
Chromosome:Gm03
Start:33726801
stop:33729028
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G17690AT Annotation by Michelle Graham. TAIR10: like heterochromatin protein (LHP1) | chr5:5827504-5829537 REVERSE LENGTH=445 SoyBaseE_val: 1.00E-26ISS
GO:0000956GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear-transcribed mRNA catabolic process SoyBaseN/AISS
GO:0006325GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin organization SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0007346GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of mitotic cell cycle SoyBaseN/AISS
GO:0009648GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009910GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of flower development SoyBaseN/AISS
GO:0010016GO-bp Annotation by Michelle Graham. GO Biological Process: shoot morphogenesis SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0016246GO-bp Annotation by Michelle Graham. GO Biological Process: RNA interference SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0045814GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of gene expression, epigenetic SoyBaseN/AISS
GO:0045857GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of molecular function, epigenetic SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0000791GO-cc Annotation by Michelle Graham. GO Cellular Compartment: euchromatin SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005720GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear heterochromatin SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0035064GO-mf Annotation by Michelle Graham. GO Molecular Function: methylated histone residue binding SoyBaseN/AISS
PTHR22812Panther CHROMOBOX PROTEIN JGI ISS
PTHR22812:SF2Panther CHROMOBOX POLYCOMB - RELATED JGI ISS
PF00385PFAM chromo' (CHRromatin Organisation MOdifier) domain JGI ISS
UniRef100_B9I6F0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chromodomain protein n=1 Tax=Populus trichocarpa RepID=B9I6F0_POPTR SoyBaseE_val: 3.00E-34ISS
UniRef100_UPI0002337494UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337494 related cluster n=1 Tax=unknown RepID=UPI0002337494 SoyBaseE_val: 4.00E-85ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g26285 not represented in the dataset

Glyma03g26285 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g111600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g26285.1   sequence type=CDS   gene model=Glyma03g26285   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGGTGGTGATGGGATGAAAAAGGCTAACTTTGAGGCTCTGAACATTGTTGTTGGTGGTGGTGGTGTTGATTTGGGTGGTGGAGATGGTGGGGGTGTCAAAGTTCAAAATTTTGAGGGGATCAAGGGTACTCGATTGCGGAAAAGTGAAGAAGAGGAAAAATCCCATGTGAAGAGTAATGAAGGTGAAGAAGAAGATGATGGCCCTGAGGGAGAGAAAGAAGATGAAGAAAATGTTGCTTGTAGTGGTACTGCTGCTGGGGCTCAAAGAGGACAACAAGGTGTTGTTGTTCTTGGTGAAAATTTCTTTGAAGTTGAAGCTATACGTCGTAAGAGGGTGCGCAAGGGTCAAGTTCAATACTTAATCAAATGGAATGGGTGGCCTGAGACAACCAACACTTGGGAGCCTCCAGAAAATCTAGAGTATATTCCTGATATTGTTGAAGCTTTTGAGGAGAGCTTGATGTCAAGAAAACATCGTAAGCGGAAACGCAAGCATATGGTGCATGATACTCAACACAAAAAGTGCAAGCATACACACTCTTCTCCTCCTCTTAATGATCATAGCCTTCCTGATATTCCCGACTTCCCTCAAACTGCGTTGTTTTGTGGTGGTGCTGAAGGCAGCAATCTTGGAAAAGCCACACCGGCCAGTAATGCTAACAAGTCTGCAAATGGTTCAAAACAAAATATTGAAAGGAATGAGGAAAATGATTATGAATCTAAAGCTATGACTATCAATGGGAATGATACAGACAAGCTTGCAATACAAATTCCAGAAGCTAAGAATAAATTGAAAGATATATATGGATATATTAAAACTTTTCTAATCAAAGTATCTCAATTTGTTAAATGA

>Glyma03g26285.1   sequence type=predicted peptide   gene model=Glyma03g26285   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKGGDGMKKANFEALNIVVGGGGVDLGGGDGGGVKVQNFEGIKGTRLRKSEEEEKSHVKSNEGEEEDDGPEGEKEDEENVACSGTAAGAQRGQQGVVVLGENFFEVEAIRRKRVRKGQVQYLIKWNGWPETTNTWEPPENLEYIPDIVEAFEESLMSRKHRKRKRKHMVHDTQHKKCKHTHSSPPLNDHSLPDIPDFPQTALFCGGAEGSNLGKATPASNANKSANGSKQNIERNEENDYESKAMTINGNDTDKLAIQIPEAKNKLKDIYGYIKTFLIKVSQFVK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo