SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g25770

Feature Type:gene_model
Chromosome:Gm03
Start:33037355
stop:33045604
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g25770
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G44745AT Annotation by Michelle Graham. TAIR10: WRKY family transcription factor | chr2:18447482-18449004 REVERSE LENGTH=218 SoyBaseE_val: 2.00E-74ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009718GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin-containing compound biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
PF03106PFAM WRKY DNA -binding domain JGI ISS
UniRef100_F8RKQ9UniRef Annotation by Michelle Graham. Most informative UniRef hit: STP n=1 Tax=Medicago truncatula RepID=F8RKQ9_MEDTR SoyBaseE_val: 2.00E-120ISS
UniRef100_I1JMP1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JMP1_SOYBN SoyBaseE_val: 3.00E-178ISS

Expression Patterns of Glyma03g25770
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g25770 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g109100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g25770
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g25770
>Glyma03g25770.1   sequence type=CDS   gene model=Glyma03g25770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGGAGGAGAGAGAGGTGTTAATCCCAATAATTATGAGCTCCAAGTTTCATTCGCAAACACCCCTCAAGCCATCCATGAAATGGGTTTTGTTCAATTTGAAGAAAACCAGGTTCTTAGCTTCTTGGCACCCTCTGCTCAATCCCAATCTTCTCAGCTCTCTCAATCTCTAAACGCCGGCAACGGTGGCAGCAATACTGCTGTTGCTGCCGCTACCACAACCGCCACCGCCACCACCTCCGGATCCGGAGCAACAATTGGTTTCAGCCATAATGACCTTGTATCCAGAACTTGTTGGAATAATAATGAACAGGTGCGAACACTGGATCCCAAAGCTGTCAATGATGAAAATTGCACCGGAAATACTAGTGATGGTGGCAACAACTCATGGTGGAGAAGTGCTGGCTCAGAGAAGAACAAGATGAAAGTGAGGAGGAAGCTGAGGGAGCCACGGTTTTGTTTCCAAACAAGAAGTGATGTAGATGTGCTTGATGATGGTTATAAATGGAGGAAGTATGGTCAGAAAGTTGTCAAGAATAGCCTTCACCCAAGAAGCTACTACCGCTGTACCCATAACAACTGTAGGGTGAAGAAAAGAGTTGAACGACTCTCTGAAGATTGTCGTATGGTAATAACTACCTATGAAGGCAGACACAACCACTCTCCTTGTGATGACTCAAATTCATCGGAACATGAATGTTTCACCTCTTTTTGA
Predicted protein sequences of Glyma03g25770
>Glyma03g25770.1   sequence type=predicted peptide   gene model=Glyma03g25770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGGERGVNPNNYELQVSFANTPQAIHEMGFVQFEENQVLSFLAPSAQSQSSQLSQSLNAGNGGSNTAVAAATTTATATTSGSGATIGFSHNDLVSRTCWNNNEQVRTLDPKAVNDENCTGNTSDGGNNSWWRSAGSEKNKMKVRRKLREPRFCFQTRSDVDVLDDGYKWRKYGQKVVKNSLHPRSYYRCTHNNCRVKKRVERLSEDCRMVITTYEGRHNHSPCDDSNSSEHECFTSF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo