SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g19920

Feature Type:gene_model
Chromosome:Gm03
Start:25387685
stop:25391898
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g19920
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G25070AT Annotation by Michelle Graham. TAIR10: RPM1 interacting protein 4 | chr3:9132458-9133747 FORWARD LENGTH=211 SoyBaseE_val: 1.00E-44ISS
GO:0002237GO-bp Annotation by Michelle Graham. GO Biological Process: response to molecule of bacterial origin SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009816GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium, incompatible interaction SoyBaseN/AISS
GO:0010204GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-independent SoyBaseN/AISS
GO:0034051GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0045087GO-bp Annotation by Michelle Graham. GO Biological Process: innate immune response SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF05627PFAM Cleavage site for pathogenic type III effector avirulence factor Avr JGI ISS
UniRef100_D8WJ54UniRef Annotation by Michelle Graham. Best UniRef hit: RIN4a protein n=1 Tax=Glycine max RepID=D8WJ54_SOYBN SoyBaseE_val: 2.00E-179ISS
UniRef100_D8WJ54UniRef Annotation by Michelle Graham. Most informative UniRef hit: RIN4a protein n=1 Tax=Glycine max RepID=D8WJ54_SOYBN SoyBaseE_val: 2.00E-179ISS

Expression Patterns of Glyma03g19920
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g19920 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g084000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g19920
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g19920
>Glyma03g19920.1   sequence type=CDS   gene model=Glyma03g19920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCACAACGTTCTCATGTACCCAAATTTGGCAATTGGGATAGTGGAGAGAATGTTCCTTATACAGCATATTTTGACAAGGCGCGGAAAGGTCGAACTGGGGCAAGGATAATAAATCCAAATGACCCTGAGGAAAATGCTGATTTAAGTCTGGATAATCCATCATCTGATCACCTACCTCCTACCAGACCCAGAGCTAATTCAGAGGATCAATCCGGAAAAGGATCATTGCCTTTGGAAGATGATCCTAAGCATTTTGTCGACTCTCCAGCTCGTCATGACAATGTAAGCAGTAGGAGTGGCAGTAGAAGCCACGGAGTAGGTTCTGCTGAAAACCGTAGAAGACATTCGACACAAAGTACTGGTTCCGAGTACAGTATTGAACGTTCACCACTTCATCGCCAGGCTAGAGCCCCTGGCAGAGACAGTCCCCAGTGGGAACCAAAGAATTCATATGACAACAGCCAGGGAACACCTGGGAGATCTCGGTTAAGACCGGTTAATCGAGGAGATGAAACACCGGATAAAGGTGCAGCTGTTCCAAAGTTTGGTGACTGGGATGTGAATAACCCATCATCAGCAGATGGCTTTACTCACATTTTCAACAAAGTGAGGGAGGAGAGACAGGGTGTCCCAGGACAAGTGCCGGGAACGCCTAATGAGAGACCACAAGCTATTAGGGGCCAATCTAACGATGACAAAGTCCAGTGTTGCTGCTTCGCATGGGGGGGCAAAAAATGA
Predicted protein sequences of Glyma03g19920
>Glyma03g19920.1   sequence type=predicted peptide   gene model=Glyma03g19920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQRSHVPKFGNWDSGENVPYTAYFDKARKGRTGARIINPNDPEENADLSLDNPSSDHLPPTRPRANSEDQSGKGSLPLEDDPKHFVDSPARHDNVSSRSGSRSHGVGSAENRRRHSTQSTGSEYSIERSPLHRQARAPGRDSPQWEPKNSYDNSQGTPGRSRLRPVNRGDETPDKGAAVPKFGDWDVNNPSSADGFTHIFNKVREERQGVPGQVPGTPNERPQAIRGQSNDDKVQCCCFAWGGKK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo