SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g19030

Feature Type:gene_model
Chromosome:Gm03
Start:24384815
stop:24388055
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g19030
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G37630AT Annotation by Michelle Graham. TAIR10: myb-like HTH transcriptional regulator family protein | chr2:15781798-15782901 REVERSE LENGTH=367 SoyBaseE_val: 7.00E-142ISS
GO:0008356GO-bp Annotation by Michelle Graham. GO Biological Process: asymmetric cell division SoyBaseN/AISS
GO:0009615GO-bp Annotation by Michelle Graham. GO Biological Process: response to virus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0009946GO-bp Annotation by Michelle Graham. GO Biological Process: proximal/distal axis specification SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010338GO-bp Annotation by Michelle Graham. GO Biological Process: leaf formation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0045088GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0000793GO-cc Annotation by Michelle Graham. GO Cellular Compartment: condensed chromosome SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0042803GO-mf Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity SoyBaseN/AISS
KOG0048 KOG Transcription factor, Myb superfamily JGI ISS
PTHR10641Panther MYB-RELATED JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_Q4VPE5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Phantastica transcription factor b n=1 Tax=Glycine max RepID=Q4VPE5_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q4VPE5UniRef Annotation by Michelle Graham. Best UniRef hit: Phantastica transcription factor b n=1 Tax=Glycine max RepID=Q4VPE5_SOYBN SoyBaseE_val: 0ISS

Proteins Associated with Glyma03g19030
LocusGene SymbolProtein Name
MYB091 MYB transcription factor 91

Expression Patterns of Glyma03g19030
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g19030 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g081900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g19030
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g19030
>Glyma03g19030.1   sequence type=CDS   gene model=Glyma03g19030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGAGAGGCAACGTTGGAGAGCTGAAGAGGATGCTTTATTACGTTCTTATGTCAAACAGTATGGTCCTAGGGAATGGAATCTTGTGTCTCAGCGCATGAACACATATCTTAACAGGGATGCTAAGTCGTGCTTGGAGAGGTGGAAGAACTACCTCAAGCCTGGCATCAAAAAAGGCTCTCTTACTGAAGAAGAGCAGCGCCTTGTCATCCACCTTCAAGCAAAATATGGAAACAAATGGAAGAAAATCGCTGCTGAAGTCCCAGGGCGCACTGCTAAGCGGTTAGGCAAGTGGTGGGAAGTCTTCAAAGAGAAGCAGCAGAGAGAGAAAAAGGAGATCAATAGAATTGCCGACCCAATTAACAATAGTAAGTACGAGCACATACTCGAGAGTTTTGCAGAGAAACTAGTTAAGGAACGCCCTTCACCATCATTTGTCATGGCTGCTTCCGATGGGGCATTTCTGCTCACTGATACACCAGCACCTGCATCTTCCTTGCGTCCTTCTTGGCTTTCCAATTCTAGTAGTGCTGCAGCCATCGGCCCAAGTTCCCTTTCTGTGAAACTAAGTCTTTCTTCCTCAACGGTGGCCACACCTCCATTTTCATGGTTGCCACCCGAGAGAGGACCAGACAATGCTCCTTTTGTTTTGGGGAATGTATCAGCGCTTCATGGAGCTATTCCAACTCTAAGTGATAGCATGCATATGTCTCAGATGGTGGAGCACTGTAAAGAGTTGGAAGAGGGGCATCGTGCTTTGGCCACGCACAAGAAGGAGGCAGCTTGGAGGTTAAGTCGGGTGGAGTTACAGTTGGAGTCAGAGAAGGCCAACCGAAGAAGGGAGAAGATTGAAGAATTTGAAGCAAAGATTAAAGCTCTTCAGGAAGAGGAGAAAGCTGCTTTAGGTAGAATTGAAGCAGAATACAGAGAACAGTTAGCTGCATTGAGGAGAGATGCTGAAAACAAGGAGCAAAAGTTGGCAGAACAATGGGATGCAAAGCATTTACGGTTTACTAGGTTACTAGAGCAATTAGGATGCAGAGCAGGGCTCCTTGAGCCAAATGCAAGATGA
Predicted protein sequences of Glyma03g19030
>Glyma03g19030.1   sequence type=predicted peptide   gene model=Glyma03g19030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKERQRWRAEEDALLRSYVKQYGPREWNLVSQRMNTYLNRDAKSCLERWKNYLKPGIKKGSLTEEEQRLVIHLQAKYGNKWKKIAAEVPGRTAKRLGKWWEVFKEKQQREKKEINRIADPINNSKYEHILESFAEKLVKERPSPSFVMAASDGAFLLTDTPAPASSLRPSWLSNSSSAAAIGPSSLSVKLSLSSSTVATPPFSWLPPERGPDNAPFVLGNVSALHGAIPTLSDSMHMSQMVEHCKELEEGHRALATHKKEAAWRLSRVELQLESEKANRRREKIEEFEAKIKALQEEEKAALGRIEAEYREQLAALRRDAENKEQKLAEQWDAKHLRFTRLLEQLGCRAGLLEPNAR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo