SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g12150): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g12150): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g12150

Feature Type:gene_model
Chromosome:Gm03
Start:15206472
stop:15208528
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G09550AT Annotation by Michelle Graham. TAIR10: AtGCP3 interacting protein 1 | chr4:6039706-6039921 FORWARD LENGTH=71 SoyBaseE_val: 2.00E-31ISS
GO:0000226GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization SoyBaseN/AISS
GO:0006661GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylinositol biosynthetic process SoyBaseN/AISS
GO:0007052GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic spindle organization SoyBaseN/AISS
GO:0051418GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule nucleation by microtubule organizing center SoyBaseN/AISS
GO:0000930GO-cc Annotation by Michelle Graham. GO Cellular Compartment: gamma-tubulin complex SoyBaseN/AISS
GO:0005635GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear envelope SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005828GO-cc Annotation by Michelle Graham. GO Cellular Compartment: kinetochore microtubule SoyBaseN/AISS
GO:0008274GO-cc Annotation by Michelle Graham. GO Cellular Compartment: gamma-tubulin ring complex SoyBaseN/AISS
GO:0009524GO-cc Annotation by Michelle Graham. GO Cellular Compartment: phragmoplast SoyBaseN/AISS
GO:0009574GO-cc Annotation by Michelle Graham. GO Cellular Compartment: preprophase band SoyBaseN/AISS
GO:0072686GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitotic spindle SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF12554PFAM Protein of unknown function (DUF3743) JGI ISS
UniRef100_C6T5S8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T5S8_SOYBN SoyBaseE_val: 3.00E-43ISS
UniRef100_Q9M0N8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitotic-spindle organizing protein 1B n=2 Tax=Arabidopsis RepID=MZT1B_ARATH SoyBaseE_val: 7.00E-29ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g12150 not represented in the dataset

Glyma03g12150 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g24550 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g068900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g12150.5   sequence type=transcript   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTCAAAATCTCAAAATAAGCATTTGGAAGAAGCGGAGGATTAAAACATAAAGGAGTGGTATAATGATTTTTTTGACAAAATTGTCCGTAGTTAAGTTTTAGAATGACACCCAATACCCCTGGACTTATCACACTCGTGACCTAACGCTGGGTGCTTCTCTTCTCTGCAGCCTCTTTGATCTGTTGGTGCTCACTTCGATCCCGTTGTGCCCTCTTCAGTTTAGGTGTTTTCATTTTAGTGATATTGTTGAACTGAACATACTCTGCCCAGTTCTCAGCTTAAAGCATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAAATAAATGGATTTTTCTATTAGATGCCATTTTGTTTATGCTTGCTAAAGTTCTTTGTAATCCATCCTATTTATCTGTTCTTGATCTGGTTCATTGAATTTCTGTGTGCTTTGATTGTTCTTCTGCATGTTCTTCATTTGATGTATAGTGAGATTGTTTTAGCACAAAACTGATATGTTGCAATTAGGAACTCTATTTGAAGGCTTATTATCTTTGAGTAAAATTTCGCATTTTGTGCTGCTAGTCTGCAATCTTGATCTTTTCACAA

>Glyma03g12150.6   sequence type=transcript   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTTTAGAATGACACCCAATACCCCTGGACTTATCACACTCGTGACCTAACGCTGGGTGCTTCTCTTCTCTGCAGCCTCTTTGATCTGTTGGTGCTCACTTCGATCCCGTTGTGCCCTCTTCAGTTTAGCTTAAAGCATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAAATAAATGGATTTTTCTATTAGATGCCATTTTGTTTATGCTTGCTAAAGTTCTTTGTAATCCATCCTATTTATCTGTTCTTGATCTGGTTCATTGAATTTCTGTGTGCTTTGATTGTTCTTCTGCATGTTCTTCATTTGATGTATAGTGAGATTGTTTTAGCACAAAACTGATATGTTGCAATTAGGAACTCTATTTGAAGGCTTATTATCTTTGAGTAAAATTTCGCATTTTGTGCTGCTAG

>Glyma03g12150.4   sequence type=CDS   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAA

>Glyma03g12150.5   sequence type=CDS   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAA

>Glyma03g12150.6   sequence type=CDS   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAA

>Glyma03g12150.4   sequence type=predicted peptide   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPEAARTARESLDLAFHMSNILDTGLDRHTLSVLIALCDLGVNPEALAAVVKELRKEKPSLSSSLPVAPSLP*

>Glyma03g12150.5   sequence type=predicted peptide   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPEAARTARESLDLAFHMSNILDTGLDRHTLSVLIALCDLGVNPEALAAVVKELRKEKPSLSSSLPVAPSLP*

>Glyma03g12150.6   sequence type=predicted peptide   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPEAARTARESLDLAFHMSNILDTGLDRHTLSVLIALCDLGVNPEALAAVVKELRKEKPSLSSSLPVAPSLP*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo