Glyma03g12150 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g12150): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g12150): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g12150

Feature Type:	gene_model
Chromosome:	Gm03
Start:	15206472
stop:	15208528
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g12150

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G09550	AT	Annotation by Michelle Graham. TAIR10: AtGCP3 interacting protein 1 \| chr4:6039706-6039921 FORWARD LENGTH=71	SoyBase	E_val: 2.00E-31	ISS
GO:0000226	GO-bp	Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization	SoyBase	N/A	ISS
GO:0006661	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphatidylinositol biosynthetic process	SoyBase	N/A	ISS
GO:0007052	GO-bp	Annotation by Michelle Graham. GO Biological Process: mitotic spindle organization	SoyBase	N/A	ISS
GO:0051418	GO-bp	Annotation by Michelle Graham. GO Biological Process: microtubule nucleation by microtubule organizing center	SoyBase	N/A	ISS
GO:0000930	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: gamma-tubulin complex	SoyBase	N/A	ISS
GO:0005635	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nuclear envelope	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005828	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: kinetochore microtubule	SoyBase	N/A	ISS
GO:0008274	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: gamma-tubulin ring complex	SoyBase	N/A	ISS
GO:0009524	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: phragmoplast	SoyBase	N/A	ISS
GO:0009574	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: preprophase band	SoyBase	N/A	ISS
GO:0072686	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitotic spindle	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PF12554	PFAM	Protein of unknown function (DUF3743)	JGI		ISS
UniRef100_C6T5S8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T5S8_SOYBN	SoyBase	E_val: 3.00E-43	ISS
UniRef100_Q9M0N8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Mitotic-spindle organizing protein 1B n=2 Tax=Arabidopsis RepID=MZT1B_ARATH	SoyBase	E_val: 7.00E-29	ISS

Expression Patterns of Glyma03g12150

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g12150 not represented in the dataset	Glyma03g12150 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g12150

Paralog	Evidence	Comments
Glyma01g24550	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g12150 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g068900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g12150

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma03g12150

Limit To All Plant Sequences

>Glyma03g12150.5   sequence type=transcript   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTCAAAATCTCAAAATAAGCATTTGGAAGAAGCGGAGGATTAAAACATAAAGGAGTGGTATAATGATTTTTTTGACAAAATTGTCCGTAGTTAAGTTTTAGAATGACACCCAATACCCCTGGACTTATCACACTCGTGACCTAACGCTGGGTGCTTCTCTTCTCTGCAGCCTCTTTGATCTGTTGGTGCTCACTTCGATCCCGTTGTGCCCTCTTCAGTTTAGGTGTTTTCATTTTAGTGATATTGTTGAACTGAACATACTCTGCCCAGTTCTCAGCTTAAAGCATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAAATAAATGGATTTTTCTATTAGATGCCATTTTGTTTATGCTTGCTAAAGTTCTTTGTAATCCATCCTATTTATCTGTTCTTGATCTGGTTCATTGAATTTCTGTGTGCTTTGATTGTTCTTCTGCATGTTCTTCATTTGATGTATAGTGAGATTGTTTTAGCACAAAACTGATATGTTGCAATTAGGAACTCTATTTGAAGGCTTATTATCTTTGAGTAAAATTTCGCATTTTGTGCTGCTAGTCTGCAATCTTGATCTTTTCACAA

>Glyma03g12150.6   sequence type=transcript   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTTTAGAATGACACCCAATACCCCTGGACTTATCACACTCGTGACCTAACGCTGGGTGCTTCTCTTCTCTGCAGCCTCTTTGATCTGTTGGTGCTCACTTCGATCCCGTTGTGCCCTCTTCAGTTTAGCTTAAAGCATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAAATAAATGGATTTTTCTATTAGATGCCATTTTGTTTATGCTTGCTAAAGTTCTTTGTAATCCATCCTATTTATCTGTTCTTGATCTGGTTCATTGAATTTCTGTGTGCTTTGATTGTTCTTCTGCATGTTCTTCATTTGATGTATAGTGAGATTGTTTTAGCACAAAACTGATATGTTGCAATTAGGAACTCTATTTGAAGGCTTATTATCTTTGAGTAAAATTTCGCATTTTGTGCTGCTAG

Coding sequences of Glyma03g12150

Limit To All Plant Sequences

>Glyma03g12150.4   sequence type=CDS   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAA

>Glyma03g12150.5   sequence type=CDS   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAA

>Glyma03g12150.6   sequence type=CDS   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCCGGAGGCTGCACGAACTGCACGAGAATCTCTAGACCTGGCATTCCATATGTCCAATATACTTGATACTGGTCTAGACCGTCACACACTTTCTGTTCTTATAGCACTTTGTGATCTTGGAGTCAATCCTGAAGCGCTTGCTGCTGTTGTCAAGGAACTAAGAAAAGAGAAACCCTCACTATCATCATCACTTCCCGTAGCTCCTTCTTTGCCATAA

Predicted protein sequences of Glyma03g12150

Limit To All Plant Sequences

>Glyma03g12150.4   sequence type=predicted peptide   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPEAARTARESLDLAFHMSNILDTGLDRHTLSVLIALCDLGVNPEALAAVVKELRKEKPSLSSSLPVAPSLP*

>Glyma03g12150.5   sequence type=predicted peptide   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPEAARTARESLDLAFHMSNILDTGLDRHTLSVLIALCDLGVNPEALAAVVKELRKEKPSLSSSLPVAPSLP*

>Glyma03g12150.6   sequence type=predicted peptide   gene model=Glyma03g12150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPEAARTARESLDLAFHMSNILDTGLDRHTLSVLIALCDLGVNPEALAAVVKELRKEKPSLSSSLPVAPSLP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain