SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g07910): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g07910): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g07910

Feature Type:gene_model
Chromosome:Gm03
Start:8652830
stop:8656723
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G51860AT Annotation by Michelle Graham. TAIR10: cation exchanger 3 | chr3:19239458-19242519 FORWARD LENGTH=459 SoyBaseE_val: 0ISS
GO:0006793GO-bp Annotation by Michelle Graham. GO Biological Process: phosphorus metabolic process SoyBaseN/AISS
GO:0006812GO-bp Annotation by Michelle Graham. GO Biological Process: cation transport SoyBaseN/AISS
GO:0006814GO-bp Annotation by Michelle Graham. GO Biological Process: sodium ion transport SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0006874GO-bp Annotation by Michelle Graham. GO Biological Process: cellular calcium ion homeostasis SoyBaseN/AISS
GO:0006882GO-bp Annotation by Michelle Graham. GO Biological Process: cellular zinc ion homeostasis SoyBaseN/AISS
GO:0009624GO-bp Annotation by Michelle Graham. GO Biological Process: response to nematode SoyBaseN/AISS
GO:0010351GO-bp Annotation by Michelle Graham. GO Biological Process: lithium ion transport SoyBaseN/AISS
GO:0030026GO-bp Annotation by Michelle Graham. GO Biological Process: cellular manganese ion homeostasis SoyBaseN/AISS
GO:0051592GO-bp Annotation by Michelle Graham. GO Biological Process: response to calcium ion SoyBaseN/AISS
GO:0055062GO-bp Annotation by Michelle Graham. GO Biological Process: phosphate ion homeostasis SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0009705GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008324GO-mf Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity SoyBaseN/AISS
GO:0015368GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium:cation antiporter activity SoyBaseN/AISS
GO:0015369GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium:hydrogen antiporter activity SoyBaseN/AISS
GO:0015491GO-mf Annotation by Michelle Graham. GO Molecular Function: cation transport SoyBaseN/AISS
KOG1397 KOG Ca2+/H+ antiporter VCX1 and related proteins JGI ISS
PF01699PFAM Sodium/calcium exchanger protein JGI ISS
UniRef100_B9SQ31UniRef Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar cation/proton exchanger 1a, putative n=1 Tax=Ricinus communis RepID=B9SQ31_RICCO SoyBaseE_val: 0ISS
UniRef100_I1JLF2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JLF2_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g07910 not represented in the dataset

Glyma03g07910 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g058300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g07910.1   sequence type=CDS   gene model=Glyma03g07910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCTCGAAACCATGAGGTATCAATGGTAAAGGAGAATGGTGGTGGTGGGAACAACCTGAAGGGGTTGAGCAAGGAAATGAGACATGGCAGAACGGCACATAACATGTCATCATCTTCTTTGCGCAAGAAATCTGACCTAACTCTTGTGTCTAAGGTTTGCTCTGGCCATGTAAGGAATGTGTTGGTGAATTTGCAAGAGGTTATTCTTGGAACCAAGCTCTCTATTCTTTTCCCTGCCATTCCCCTAGCCATTGTTGCTGAAGGCTATGGCTTTGGAAGATCTTGGGTTTTTGTGTTGAGTTTACTTGGGCTCACACCACTTGCGGAACGAGTCAGCTTCTTGACAGAACAAGTTGCTTTTTACACTGGTCCTGCAGTGGGAGCACTTTTGAATGCAACATGTGGGAATGCTACAGAGCTCATCATAGCAATTTTTGCCCTTAGCCATAACAAAATTGCTTTGGTCAAATATTCTCTCTTGGGTTCCATAATTTCTAACCTTCTTCTGGTTCTTGGAACCTCTCTATTCATTGGTGGCCTAGCAAATCTTAGTCAGGAACAAAAATACGACAGAAAACAAGCAGATATGAACTTGCTTATGTTGTTTGTGGCATTGCTTTGCCACTTGCTGCCATTGTTTGTCAGAGCTGCTAGCATTGTTATGGTGATTGCATATTGTGCTTACCTTGTCTTCCAACTGTGGACTCACAGGCAGCTATTTGAAGCCCAGAATGAAGATGATGAAGAGGGTGGCAGTGATTCAGAAGCAGTGATAGGATTCTGGAGTGGGTTTACTTGGCTGGTTGGGATGACTATGACCATTGCTTTGTTGTCTGAATATGTGGTGCAAACAATTGAGGATGCATCTGATTCATGGGGTTTGTCTGTTAGCTTCCTTAGCATAATCTTGCTTCCAATTTTTGGCAATGCAACTGAACATGCAGCAGCAATCATATTTGGTTTCAAGAACAAACTGGACATCTCTTTGGGTGTTTCTTTGGGTTCTTCAACTCAAATTAGCATGTTTGTGGTTCCCCTATGTGTGATTGTTGCTTGGATTATGGGTATCAAAATGGACCTCAACTTCAACCTCCTAGAAACAGCTTCTCTTTCTTTGGCAATAACAATCACAGCCTTCGCATTACAGGATGGAACTTCCCACTACATGAAAGGCCTTGTTCTCATACTCTGCTATATTGTTATTGGGGCATGCTTTTTCGTACAAAGAACACCCCCT

>Glyma03g07910.1   sequence type=predicted peptide   gene model=Glyma03g07910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASRNHEVSMVKENGGGGNNLKGLSKEMRHGRTAHNMSSSSLRKKSDLTLVSKVCSGHVRNVLVNLQEVILGTKLSILFPAIPLAIVAEGYGFGRSWVFVLSLLGLTPLAERVSFLTEQVAFYTGPAVGALLNATCGNATELIIAIFALSHNKIALVKYSLLGSIISNLLLVLGTSLFIGGLANLSQEQKYDRKQADMNLLMLFVALLCHLLPLFVRAASIVMVIAYCAYLVFQLWTHRQLFEAQNEDDEEGGSDSEAVIGFWSGFTWLVGMTMTIALLSEYVVQTIEDASDSWGLSVSFLSIILLPIFGNATEHAAAIIFGFKNKLDISLGVSLGSSTQISMFVVPLCVIVAWIMGIKMDLNFNLLETASLSLAITITAFALQDGTSHYMKGLVLILCYIVIGACFFVQRTPP







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo