SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g06830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g06830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g06830

Feature Type:gene_model
Chromosome:Gm03
Start:7115422
stop:7117128
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G79440AT Annotation by Michelle Graham. TAIR10: aldehyde dehydrogenase 5F1 | chr1:29882525-29887275 REVERSE LENGTH=528 SoyBaseE_val: 3.00E-35ISS
GO:0006333GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin assembly or disassembly SoyBaseN/AISS
GO:0006540GO-bp Annotation by Michelle Graham. GO Biological Process: glutamate decarboxylation to succinate SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009450GO-bp Annotation by Michelle Graham. GO Biological Process: gamma-aminobutyric acid catabolic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0072593GO-bp Annotation by Michelle Graham. GO Biological Process: reactive oxygen species metabolic process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005759GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial matrix SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0004028GO-mf Annotation by Michelle Graham. GO Molecular Function: 3-chloroallyl aldehyde dehydrogenase activity SoyBaseN/AISS
GO:0004777GO-mf Annotation by Michelle Graham. GO Molecular Function: succinate-semialdehyde dehydrogenase (NAD+) activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016620GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
PTHR11699Panther ALDEHYDE DEHYDROGENASE-RELATED JGI ISS
PTHR11699:SF49Panther GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE JGI ISS
PF00171PFAM Aldehyde dehydrogenase family JGI ISS
UniRef100_B9SUZ1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Succinate semialdehyde dehydrogenase, putative n=1 Tax=Ricinus communis RepID=B9SUZ1_RICCO SoyBaseE_val: 1.00E-35ISS
UniRef100_I1MJE1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MJE1_SOYBN SoyBaseE_val: 6.00E-40ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g06830 not represented in the dataset

Glyma03g06830 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g052700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma03g06830.1   sequence type=CDS   gene model=Glyma03g06830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTTGTAGACCAAGTCATGATATCCAAGCCATTGTCTCCTGCTCGGATTCAAACCAATGAAGCATTTGGACCTGTTGCACCCCTTTTGAGATTCAAAACTAAAGAGGAAGCTATCAGAATTGCTAATGACACTAATGCAGGTTTGGGTTCATATGCTCTTGAATATGGACTAGTGGGTGTTAATGAAGGAGTAATTTCAACTGAGGTGGCTCCATTTGGTGGTTTTAAACAGTCTGGCCTCGGAAGAGAAGGCTCCAAATATGGGATGGATGAATATTTAGAGCCACTGATTATACTTGTGCAACTTTTGTCTTTTGAAGTTTGTAAAACTGAGTTTGGTTATGGTTTGAAGAATCTAGAAAAGAGGGCATATTTGTGTAGAATTATGTGTGGTGGATGTTTTGGGTCAATGGGTATGGGCTGA

>Glyma03g06830.1   sequence type=predicted peptide   gene model=Glyma03g06830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
FVDQVMISKPLSPARIQTNEAFGPVAPLLRFKTKEEAIRIANDTNAGLGSYALEYGLVGVNEGVISTEVAPFGGFKQSGLGREGSKYGMDEYLEPLIILVQLLSFEVCKTEFGYGLKNLEKRAYLCRIMCGGCFGSMGMG*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo