|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G05100 | AT | Annotation by Michelle Graham. TAIR10: myb domain protein 74 | chr4:2618557-2619790 FORWARD LENGTH=324 | SoyBase | E_val: 1.00E-20 | ISS |
| GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0007165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: signal transduction | SoyBase | N/A | ISS |
| GO:0009414 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to water deprivation | SoyBase | N/A | ISS |
| GO:0009611 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to wounding | SoyBase | N/A | ISS |
| GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
| GO:0009695 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009723 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus | SoyBase | N/A | ISS |
| GO:0009733 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus | SoyBase | N/A | ISS |
| GO:0009737 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus | SoyBase | N/A | ISS |
| GO:0009738 | GO-bp | Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009753 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009873 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0042538 | GO-bp | Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0003677 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: DNA binding | SoyBase | N/A | ISS |
| GO:0003700 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity | SoyBase | N/A | ISS |
| PTHR10641 | Panther | MYB-RELATED | JGI | ISS | |
| PF00249 | PFAM | Myb-like DNA-binding domain | JGI | ISS | |
| UniRef100_I1M3E2 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M3E2_SOYBN | SoyBase | E_val: 5.00E-21 | ISS |
| UniRef100_Q84LP8 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: MYB1 n=1 Tax=Paraboea crassifolia RepID=Q84LP8_9LAMI | SoyBase | E_val: 5.00E-18 | ISS |
|
Glyma03g06225 not represented in the dataset |
Glyma03g06225 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.03g047600 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma03g06225.1 sequence type=CDS gene model=Glyma03g06225 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTGGAAAGAGTTGCCGGCTTCGCTGGGCAAACTACTTGAGGCCCGATATAAAGAGAGGGAGATTCTCATTCGAAGAAGAAGAAGCCATCATTCAGTTACACAGTGTTTTGGGAAAAAGTGGTCTACAATTGCTGCTAACTTGCCAGGAAGAACAGATAATGAGATCAAGAATTATTGGAACACTCACATCAAGAAAAAGCTATTGAAGATGGGGATTGATCCTATGACTCACACACATCTTTATGCAATTTACCACCCCAATGTTAGAAAATAA
>Glyma03g06225.1 sequence type=predicted peptide gene model=Glyma03g06225 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MWKELPASLGKLLEARYKEREILIRRRRSHHSVTQCFGKKWSTIAANLPGRTDNEIKNYWNTHIKKKLLKMGIDPMTHTHLYAIYHPNVRK*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||