|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G31500 | AT | Annotation by Michelle Graham. TAIR10: cytochrome P450, family 83, subfamily B, polypeptide 1 | chr4:15273677-15275271 REVERSE LENGTH=499 | SoyBase | E_val: 1.00E-159 | ISS |
| GO:0000096 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process | SoyBase | N/A | ISS |
| GO:0000162 | GO-bp | Annotation by Michelle Graham. GO Biological Process: tryptophan biosynthetic process | SoyBase | N/A | ISS |
| GO:0006520 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular amino acid metabolic process | SoyBase | N/A | ISS |
| GO:0006546 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glycine catabolic process | SoyBase | N/A | ISS |
| GO:0006569 | GO-bp | Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process | SoyBase | N/A | ISS |
| GO:0006636 | GO-bp | Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0006733 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process | SoyBase | N/A | ISS |
| GO:0006766 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process | SoyBase | N/A | ISS |
| GO:0008652 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009072 | GO-bp | Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process | SoyBase | N/A | ISS |
| GO:0009106 | GO-bp | Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process | SoyBase | N/A | ISS |
| GO:0009108 | GO-bp | Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process | SoyBase | N/A | ISS |
| GO:0009117 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process | SoyBase | N/A | ISS |
| GO:0009641 | GO-bp | Annotation by Michelle Graham. GO Biological Process: shade avoidance | SoyBase | N/A | ISS |
| GO:0009682 | GO-bp | Annotation by Michelle Graham. GO Biological Process: induced systemic resistance | SoyBase | N/A | ISS |
| GO:0009684 | GO-bp | Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009695 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009759 | GO-bp | Annotation by Michelle Graham. GO Biological Process: indole glucosinolate biosynthetic process | SoyBase | N/A | ISS |
| GO:0010114 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to red light | SoyBase | N/A | ISS |
| GO:0019288 | GO-bp | Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway | SoyBase | N/A | ISS |
| GO:0019748 | GO-bp | Annotation by Michelle Graham. GO Biological Process: secondary metabolic process | SoyBase | N/A | ISS |
| GO:0019761 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process | SoyBase | N/A | ISS |
| GO:0042742 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to bacterium | SoyBase | N/A | ISS |
| GO:0044272 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process | SoyBase | N/A | ISS |
| GO:0048830 | GO-bp | Annotation by Michelle Graham. GO Biological Process: adventitious root development | SoyBase | N/A | ISS |
| GO:0052544 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response by callose deposition in cell wall | SoyBase | N/A | ISS |
| GO:0055114 | GO-bp | Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0005783 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0005506 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: iron ion binding | SoyBase | N/A | ISS |
| GO:0009055 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: electron carrier activity | SoyBase | N/A | ISS |
| GO:0016705 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen | SoyBase | N/A | ISS |
| GO:0016709 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen | SoyBase | N/A | ISS |
| GO:0019825 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: oxygen binding | SoyBase | N/A | ISS |
| GO:0020037 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: heme binding | SoyBase | N/A | ISS |
| KOG0156 | KOG | Cytochrome P450 CYP2 subfamily | JGI | ISS | |
| PTHR24298 | Panther | FAMILY NOT NAMED | JGI | ISS | |
| PTHR24298:SF44 | Panther | JGI | ISS | ||
| PF00067 | PFAM | Cytochrome P450 | JGI | ISS | |
| UniRef100_I1JKT0 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JKT0_SOYBN | SoyBase | E_val: 0 | ISS |
| UniRef100_Q2LAL4 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 monooxygenase CYP83E8 n=1 Tax=Glycine max RepID=Q2LAL4_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma03g03590 not represented in the dataset |
Glyma03g03590 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.03g030600 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma03g03590.1 sequence type=CDS gene model=Glyma03g03590 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGTGTCACCACATCTAATTCTATACATAACTCTTCCCATGCTTTTGTTGTTCTTCTACCAATATCGCAGAGCGTTCAAGAACTCAACCCTTCCACCTGGTCCTAGAGGCCTTCCCATAATAGGGAATCTTCATCAGCTAAATAGTTCTTCTCTTTATCTGCAACTATGGCAACTCTCAAAGAAATACGGTCCTCTATTTTCTCTTCAATTAGGTTTAAGACCAGCCATAGTTGTTTCCTCCCATAAATTGGCCAGAGAGGCATTGAAAGACAACGACCTTGAGTTTAGTGGACGACCTAAATTACTTGGCCAGCAGAAACTGTCCTACAATGGGTTAGAGATGATATTTTCCCCATATGGTGAGTTTTGGAGACAAATTAGAAAAATTTGTGTTGTCCATGTCCTTAGCTCAAGACGTGTCTCAAGATTTTCCTCAATAAGAAACTTTGAGGTCAAGCAAATGATTAAAAGAATATCCTTGCACGCCTCATCTTCAAAAGTTACAAATTTGAATGAAGTGCTAATGTCTCTTACTAGCACTATTATATGTAGAATTGCCTTTGGGAGAAGCTATGAAGATGAAGAAACCGAAAGGAGTAAGTTCCATGGTATGCTAAATGAGTGTCAAGCCATGTGGGGAACCTTGTTTATCTCAGATTATATTCCTTTCTTGGGTTGGATTGATAAACTGAGGGGACTGCATGCACGTCTTGAACGGAATTTCAAGGAGTTGGATGAGTTCTACCAAGAAGTTATTGATGAACACATGAATCCTAATAGAAAGACCACAAAGAATGAGGATATAACAGATGTGTTGCTTCAACTGAAGATGCAGCGTTTGTATTCCATAGATCTCACAAATGATCACATCAAAGCGGTGCTCATGGACATGCTTGTGGCAGCAACGGATACAACTTCAACCACAACAGTGTGGGCTATGGTTGCTCTACTAAAGAATCCAAGAGTAATGAAGAAAGTTCAAGAAGAAATTAGGACTTTGGGAGGTAAAAAAGATTTTCTAGATGAAGATGATATTCAGAAATTTCCCTATTTCAAGGCTGTGATAAAAGAGACACTGAGACTGTATCTACCAGCACCGTTGCTGGTGCAAAGAGAAACAAATGAAGCATGTATTATAGATGGTTATGAAATTCCAGCAAAAACAATAGTCTATGTGAATGCTTGGGCTATCCATAGAGACCCTAAGGTTTGGAAAGACCCAGATGAGTTTTTACCCGAGAGGTTCTTAGATAATACTATAGATTTTCGAGGCCAAGATTTTGAGTTAATTCCATTTGGTGCTGGTCGTAGAATATGCCCTGGCATGCCTATGGCAATTGCTTCATTGGATCTTATTCTTGCTAATCTTCTTAATTCTTTTAATTGGGAATTGCCAGCAGGAATGACAAAAGAAGACATTGATACTGAAATGTTGCCAGGACTTAGTCAGCATAAGAAGAACCCTCTTTATGTTTTGGCCAAGTGTAGAATCTAA
>Glyma03g03590.1 sequence type=predicted peptide gene model=Glyma03g03590 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MVSPHLILYITLPMLLLFFYQYRRAFKNSTLPPGPRGLPIIGNLHQLNSSSLYLQLWQLSKKYGPLFSLQLGLRPAIVVSSHKLAREALKDNDLEFSGRPKLLGQQKLSYNGLEMIFSPYGEFWRQIRKICVVHVLSSRRVSRFSSIRNFEVKQMIKRISLHASSSKVTNLNEVLMSLTSTIICRIAFGRSYEDEETERSKFHGMLNECQAMWGTLFISDYIPFLGWIDKLRGLHARLERNFKELDEFYQEVIDEHMNPNRKTTKNEDITDVLLQLKMQRLYSIDLTNDHIKAVLMDMLVAATDTTSTTTVWAMVALLKNPRVMKKVQEEIRTLGGKKDFLDEDDIQKFPYFKAVIKETLRLYLPAPLLVQRETNEACIIDGYEIPAKTIVYVNAWAIHRDPKVWKDPDEFLPERFLDNTIDFRGQDFELIPFGAGRRICPGMPMAIASLDLILANLLNSFNWELPAGMTKEDIDTEMLPGLSQHKKNPLYVLAKCRI*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||