Glyma03g01820 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma03g01820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma03g01820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma03g01820

Feature Type:	gene_model
Chromosome:	Gm03
Start:	1560948
stop:	1561951
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g01820

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G45760	AT	Annotation by Michelle Graham. TAIR10: BON association protein 2 \| chr2:18847125-18847748 REVERSE LENGTH=207	SoyBase	E_val: 7.00E-12	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009693	GO-bp	Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0005575	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cellular component	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_H9DXV8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: BAP1 n=1 Tax=Vitis vinifera RepID=H9DXV8_VITVI	SoyBase	E_val: 2.00E-27	ISS
UniRef100_I1JKD7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JKD7_SOYBN	SoyBase	E_val: 3.00E-125	ISS

Expression Patterns of Glyma03g01820

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma03g01820 not represented in the dataset	Glyma03g01820 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma03g01820 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g016100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g01820

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma03g01820

Limit To All Plant Sequences

>Glyma03g01820.1   sequence type=CDS   gene model=Glyma03g01820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGGCAAGCTCGGGTACAGTACTAGAGATCACAGTTATATCATGCGAAAACCTTCGTGTCACGGAGGATCCGTACGTTGTCGTTAGGGCAGAGTCCTTAAAGTGTTGCACCACGAAGATGGCGAAAGATAGTGGGAGCAACAAAACGGGTTTGTTTTCGTGGAACGAGAAGTTGATGCTGAACATGCCCATGCATGCAAGGTCCATCACGTTCGAGGTGCAATGCAACAGGTTCAAGGGTCTTCGACCCGTCGGGGTGGCAAGAATTGCGGTTTCCGATTTTCTCGGCGGCGCTGCCGTGTCGGAAAATTGCTTGCATGAGTTGAGTTACCGGCTGAGGGACTGGGAAGGGAAGGGAAACGGGGTGATTCATTTCGGGGTGAGGGTGGTGCCGCCGGAGGAACGTTCGAATGCTGCCGTGAAACCGGTGAAGGGAATGACGGTGAGTAAGGATTCCGGTGATTATAAGTCAAATGAAGTTGTTGGTGTCCCGTTTTGGTGGAACTACCCTAACGTTATTTGA

Predicted protein sequences of Glyma03g01820

Limit To All Plant Sequences

>Glyma03g01820.1   sequence type=predicted peptide   gene model=Glyma03g01820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGASSGTVLEITVISCENLRVTEDPYVVVRAESLKCCTTKMAKDSGSNKTGLFSWNEKLMLNMPMHARSITFEVQCNRFKGLRPVGVARIAVSDFLGGAAVSENCLHELSYRLRDWEGKGNGVIHFGVRVVPPEERSNAAVKPVKGMTVSKDSGDYKSNEVVGVPFWWNYPNVI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain