SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g48190): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g48190): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g48190

Feature Type:gene_model
Chromosome:Gm02
Start:51616283
stop:51617880
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G35440AT Annotation by Michelle Graham. TAIR10: chloride channel E | chr4:16836384-16839345 REVERSE LENGTH=710 SoyBaseE_val: 1.00E-39ISS
GO:0006821GO-bp Annotation by Michelle Graham. GO Biological Process: chloride transport SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005216GO-mf Annotation by Michelle Graham. GO Molecular Function: ion channel activity SoyBaseN/AISS
GO:0005247GO-mf Annotation by Michelle Graham. GO Molecular Function: chloride transport SoyBaseN/AISS
PTHR11689Panther CHLORIDE CHANNEL JGI ISS
PTHR11689:SF49Panther SUBFAMILY NOT NAMED JGI ISS
PF00654PFAM Voltage gated chloride channel JGI ISS
UniRef100_D8T5G8UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Selaginella moellendorffii RepID=D8T5G8_SELML SoyBaseE_val: 8.00E-50ISS
UniRef100_E2GMA7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chloride channel ClC7 n=2 Tax=Vitis vinifera RepID=E2GMA7_VITVI SoyBaseE_val: 1.00E-44ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g48190 not represented in the dataset

Glyma02g48190 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma14g00270 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g48190.1   sequence type=CDS   gene model=Glyma02g48190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATAATATCTTCATGCTTGGTTGGTCTCCTCACCGTCGTCGCTATCATGCTCTTCAATTATGTTGTCCATGAAATTTATGATTTGTTCTGGGATGGGATTCCTAATCAAGGCGCTTCATGGCTGAGAGAAGCGCCTATTGAGACAATATGGGCACAAGTAGTACTAGTTCCGACTTTTGGAGGTGTTATTGCAAGAAGATCCTTTCCTCCAAACTCCATTTGCCTACCTAAGTCTGCTTCCCGCCCTTTCTTAAAGGCCATGGCAGCTTTTGTTACTCTAGGCACCGGCAATTCCTTGGGTCCAGAGGGTCCAAGTGTCGACATTGAGTTCCGGCAGAATGCTCTCCCTTCTCACCGCTGGATCTCGCTGGCCTCTCTGCCGGTTTCAATGCTGCTGTTGCCGGATGTTTTTTCGCTGTTGAGTCTTGCTGTCATACTGACTGTGCCTATCTTACAAACATACAACTTAGAAGGGCTGTACCTGGACATTTCGTTACAAACTTGGTTAAATCTATTCCTTTTCTCCTACAATGAAGATTTAAGCAGCCAAATGCAATATGCCCATTTTACTTTTATCTTTCTGCTTCAATATGATTTCATTTGTAAAATTCTGCTTACAGAAATTCAGAGCTCCCACTGTATCTATTGCTGGGTATTTTATGTGGCCTGGTGTCATTGGCCCCTATCTAAATGTACATCATATATGTTGACTATTGTTGACAATCTGCACAAGGCCACTGGAATTCCACGATCTTCATTCCCTGTATTGGGAGGCTTATCAGTTGGGTTGATAGCATTGATATATCCAGAAATCCTCTACTGGGGTTTTGAGAATGTTGACATTTTATTAGAATCTCAGCCATTTGTTAAAGGCCTTTCCACTGACCTATTGCTTCTGCTAATAACTGTCAAGATAGTTGTAACTTCTCTGTGCAGGGCTTCTGGATTAGTGGGAGGGTATTATGCC

>Glyma02g48190.1   sequence type=predicted peptide   gene model=Glyma02g48190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
IISSCLVGLLTVVAIMLFNYVVHEIYDLFWDGIPNQGASWLREAPIETIWAQVVLVPTFGGVIARRSFPPNSICLPKSASRPFLKAMAAFVTLGTGNSLGPEGPSVDIEFRQNALPSHRWISLASLPVSMLLLPDVFSLLSLAVILTVPILQTYNLEGLYLDISLQTWLNLFLFSYNEDLSSQMQYAHFTFIFLLQYDFICKILLTEIQSSHCIYCWVFYVAWCHWPLSKCTSYMLTIVDNLHKATGIPRSSFPVLGGLSVGLIALIYPEILYWGFENVDILLESQPFVKGLSTDLLLLLITVKIVVTSLCRASGLVGGYYA







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo