Warning : Undefined variable $sxsome in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $sstart in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $send in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g48160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1019
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g48160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1021
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1025
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1031
Report for Sequence Feature Glyma02g48160
Feature Type: gene_model
Chromosome: Gm02
Start: 51587966
stop: 51594546
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma02g48160
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G17290 AT
Annotation by Michelle Graham. TAIR10: Calcium-dependent protein kinase family protein | chr2:7517005-7519239 FORWARD LENGTH=544
SoyBase E_val: 0 ISS
GO:0000165 GO-bp
Annotation by Michelle Graham. GO Biological Process: MAPK cascade
SoyBase N/A ISS
GO:0006468 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein phosphorylation
SoyBase N/A ISS
GO:0006499 GO-bp
Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation
SoyBase N/A ISS
GO:0006612 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane
SoyBase N/A ISS
GO:0006820 GO-bp
Annotation by Michelle Graham. GO Biological Process: anion transport
SoyBase N/A ISS
GO:0006862 GO-bp
Annotation by Michelle Graham. GO Biological Process: nucleotide transport
SoyBase N/A ISS
GO:0006888 GO-bp
Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport
SoyBase N/A ISS
GO:0007154 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell communication
SoyBase N/A ISS
GO:0007165 GO-bp
Annotation by Michelle Graham. GO Biological Process: signal transduction
SoyBase N/A ISS
GO:0009409 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to cold
SoyBase N/A ISS
GO:0009414 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to water deprivation
SoyBase N/A ISS
GO:0009611 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to wounding
SoyBase N/A ISS
GO:0009723 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus
SoyBase N/A ISS
GO:0009733 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus
SoyBase N/A ISS
GO:0009737 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus
SoyBase N/A ISS
GO:0009738 GO-bp
Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009753 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus
SoyBase N/A ISS
GO:0009862 GO-bp
Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009867 GO-bp
Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway
SoyBase N/A ISS
GO:0010119 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement
SoyBase N/A ISS
GO:0010359 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of anion channel activity
SoyBase N/A ISS
GO:0010363 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response
SoyBase N/A ISS
GO:0015696 GO-bp
Annotation by Michelle Graham. GO Biological Process: ammonium transport
SoyBase N/A ISS
GO:0015802 GO-bp
Annotation by Michelle Graham. GO Biological Process: basic amino acid transport
SoyBase N/A ISS
GO:0030968 GO-bp
Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response
SoyBase N/A ISS
GO:0031348 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response
SoyBase N/A ISS
GO:0035556 GO-bp
Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction
SoyBase N/A ISS
GO:0042538 GO-bp
Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response
SoyBase N/A ISS
GO:0043069 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death
SoyBase N/A ISS
GO:0043090 GO-bp
Annotation by Michelle Graham. GO Biological Process: amino acid import
SoyBase N/A ISS
GO:0043269 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of ion transport
SoyBase N/A ISS
GO:0046777 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation
SoyBase N/A ISS
GO:0050832 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to fungus
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0004672 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein kinase activity
SoyBase N/A ISS
GO:0004674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity
SoyBase N/A ISS
GO:0004683 GO-mf
Annotation by Michelle Graham. GO Molecular Function: calmodulin-dependent protein kinase activity
SoyBase N/A ISS
GO:0005509 GO-mf
Annotation by Michelle Graham. GO Molecular Function: calcium ion binding
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0005524 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATP binding
SoyBase N/A ISS
GO:0016301 GO-mf
Annotation by Michelle Graham. GO Molecular Function: kinase activity
SoyBase N/A ISS
GO:0016772 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups
SoyBase N/A ISS
KOG0032
KOG
Ca2+/calmodulin-dependent protein kinase, EF-Hand protein superfamily
JGI ISS
PTHR24349 Panther
SERINE/THREONINE-PROTEIN KINASE
JGI ISS
PF00036 PFAM
EF hand
JGI ISS
PF00069 PFAM
Protein kinase domain
JGI ISS
UniRef100_B0FC97 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Calcium-dependent protein kinase n=1 Tax=Swainsona canescens RepID=B0FC97_9FABA
SoyBase E_val: 0 ISS
UniRef100_I1JJW5 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JJW5_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma02g48160
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma02g48160
Paralog Evidence Comments
Glyma14g00320 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma02g48160 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.02g311800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma02g48160
Coding sequences of Glyma02g48160
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma02g48160.1 sequence type=CDS gene model=Glyma02g48160 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGGCAACACTTGCCGCGGATCTTTGAAAGGTAAATATTCTCAGGGCTTGAGCCAGCCCGAAGACCATTCAAAGCCCACCACCACCCATTCTGATCCCTCCTCCGACCACCCCTCTACCAAGCAATCTGCAGAAAACTACAACAACAACAACTATCTTCCCTTCAACGCCAAGAGAGAGTCCATCATGCGCCGCGGCCTCGACAACCAAGCCTATTATGTCTTGGGCCATAAGACTCCCAACATTCGTGATCTATACACTCTTGGCCGTAAATTGGGACAGGGCCAATTTGGTACCACTTATTTATGCACCGAGAATGCTACCTCCATTGAATATGCCTGCAAATCCATCTCCAAAAGGAAGTTGATTTCCAAGGAGGACGTTGAGGACGTTAGGAGGGAAATTCAGATAATGCATCATTTAGCTGGTCACAAGAACATTGTCACCATCAAGGGTGCTTATGAGGATCCACTCTATGTTCATATTGTCATGGAGCTTTGTTCCGGGGGTGAGTTGTTTGATCGCATCATCCAGAGGGGCCACTATACCGAGAGGAAGGCCGCTGACTTGACCAAAATTATTGTTGGTGTTGTTGAGGCTTGCCATTCCCTTGGGGTCATGCATAGAGATCTCAAGCCTGAAAACTTTCTCTTGGTCAACAAAGATGATGATTTCTCTCTTAAAGCCATTGACTTTGGCCTCTCCGTTTTCTTCAAACCCGGTCAAGTTTTCACTGATGTAGTCGGCAGCCCATACTATGTTGCTCCTGAGGTTCTCCTCAAACATTATGGGCCTGAAGCAGATGTGTGGACAGCGGGTGTCATACTGTACATATTGCTTAGTGGAGTGCCGCCATTTTGGGCAGAGACCCAGCAGGGTATATTTGATGCAGTATTGAAGGGACTTATAGATTTTGACTCAGATCCTTGGCCTCTAATATCTGACAGTGCAAAAGATCTGATTAGAAAGATGCTGTGTTCTCGGCCTTCAGAACGGTTGACTGCTCATCAAGTGTTATGTCATCCTTGGATATGTGAAAATGGAGTTGCCCCTGACAGGTCACTGGACCCTGCTGTTCTTTCTCGTCTCAAACAGTTTTCTGCTATGAATAAGCTAAAGAAGATGGCTCTGCGAGTGATTGCTGAAAGTCTATCCGAAGAGGAGATTGCCGGTTTGAGAGAAATGTTTCAGGCTATGGATACTGATAACAGTGGTGCAATCACTTTCGATGAACTCAAAGCTGGTCTAAGAAGATATGGGTCTACCCTTAAGGATATAGAAATACGTGATCTTATGGAAGCGGCTGATGTGGACAAAAGTGGAACCATAGACTATGGGGAGTTTATTGCTGCAACAGTTCATCTCAACAAACTAGAGCGTGAAGAACATCTCATTGCAGCATTCCAATATTTTGACAAGGATGGTAGTGGGTACATTACAGTTGATGAACTTCAACAAGCTTGTGCAGAACAAAACATGACTGACGCTTTTCTTGAAGACATCATTAGAGAAGTTGATCAAGATAATGATGGAAGGATTGATTATGGTGAATTTGCTGCCATGATGCAAAAAGGCAACGCTGGAATTGGTAGGAGAACTATGCGCAACAGTCTGAATTTAAGCATGAGAGATGCACCAAGTGCTCAATAG
Predicted protein sequences of Glyma02g48160
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma02g48160.1 sequence type=predicted peptide gene model=Glyma02g48160 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MGNTCRGSLKGKYSQGLSQPEDHSKPTTTHSDPSSDHPSTKQSAENYNNNNYLPFNAKRESIMRRGLDNQAYYVLGHKTPNIRDLYTLGRKLGQGQFGTTYLCTENATSIEYACKSISKRKLISKEDVEDVRREIQIMHHLAGHKNIVTIKGAYEDPLYVHIVMELCSGGELFDRIIQRGHYTERKAADLTKIIVGVVEACHSLGVMHRDLKPENFLLVNKDDDFSLKAIDFGLSVFFKPGQVFTDVVGSPYYVAPEVLLKHYGPEADVWTAGVILYILLSGVPPFWAETQQGIFDAVLKGLIDFDSDPWPLISDSAKDLIRKMLCSRPSERLTAHQVLCHPWICENGVAPDRSLDPAVLSRLKQFSAMNKLKKMALRVIAESLSEEEIAGLREMFQAMDTDNSGAITFDELKAGLRRYGSTLKDIEIRDLMEAADVDKSGTIDYGEFIAATVHLNKLEREEHLIAAFQYFDKDGSGYITVDELQQACAEQNMTDAFLEDIIREVDQDNDGRIDYGEFAAMMQKGNAGIGRRTMRNSLNLSMRDAPSAQ*