Glyma02g47780 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g47780

Feature Type:	gene_model
Chromosome:	Gm02
Start:	51261373
stop:	51263744
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g47780

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G07880	AT	Annotation by Michelle Graham. TAIR10: Immunoglobulin E-set superfamily protein \| chr3:2514175-2515544 FORWARD LENGTH=240	SoyBase	E_val: 3.00E-114	ISS
GO:0007015	GO-bp	Annotation by Michelle Graham. GO Biological Process: actin filament organization	SoyBase	N/A	ISS
GO:0009932	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell tip growth	SoyBase	N/A	ISS
GO:0010053	GO-bp	Annotation by Michelle Graham. GO Biological Process: root epidermal cell differentiation	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005094	GO-mf	Annotation by Michelle Graham. GO Molecular Function: Rho GDP-dissociation inhibitor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG3205	KOG	Rho GDP-dissociation inhibitor	JGI		ISS
PTHR10980	Panther	RHO GDP-DISSOCIATION INHIBITOR-RELATED	JGI		ISS
PTHR10980:SF2	Panther	RHO GUANINE DISSOCIATION INHIBITOR-RELATED	JGI		ISS
PF02115	PFAM	RHO protein GDP dissociation inhibitor	JGI		ISS
UniRef100_G7J8X4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: RHO protein GDP dissociation inhibitor n=1 Tax=Medicago truncatula RepID=G7J8X4_MEDTR	SoyBase	E_val: 3.00E-126	ISS
UniRef100_I1JJS8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JJS8_SOYBN	SoyBase	E_val: 6.00E-172	ISS

Expression Patterns of Glyma02g47780

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g47780

Paralog	Evidence	Comments
Glyma14g00840	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g47780 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g307600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g47780

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g47780

Limit To All Plant Sequences

>Glyma02g47780.1   sequence type=CDS   gene model=Glyma02g47780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGTTCGATGAAAACAAAGAAACTGGAGAGAAAAGTGGGGCAACGGATCATGCAAATGAAGAACATTATAAAAGTGATGGCGAGCCCTTGAGAAGGCACGTGAGTGATGAGTCCTCTATCCATGCAACTGAAGATGATCATGAGGAGGATGAAGTTGGATCCAAATTACAATTGGGTCCTCAGTGCACTCTGAAAGAGCACCTTGAGAAAGATAAGGACGATGAGAGTTTAAGGAGATGGAAGGAGCAACTCCTTGGAAGTGTGGATGTGAACAATGTTGCAGAAATTCTGGACCCTGAAGTGACTATTACTTGTTTGACTATCATCTCTCCTGATAGAGATGACATTGTTCTTCCCATTCCTGAAAATGGGACTCCAAAGGGTTTATGGTTTACTCTTAAAGAAGGTAGTCATTACCGCTTGAAATTCACCTTCCATGTGAGCAATAATATTGTGTCTGGCTTGAAATACACCAATACTGTTTGGAAGACAGCGGTCAAAGTGGATAGCTCAAAAGAGATGCTTGGAACTTTCAGCCCTCAGGCAGAGCCTTACACACATGAGATGCCAGAAGAAACCACACCCTCTGGGCTATTTGCAAGAGGATCATATTCTGCAAGATCAAAGTTTCTTGATGATGACAACAAATGCTACTTGGAGATCAACTATACTTTTGATATTAGGAAGGAATGGGCTTGA

Predicted protein sequences of Glyma02g47780

Limit To All Plant Sequences

>Glyma02g47780.1   sequence type=predicted peptide   gene model=Glyma02g47780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGFDENKETGEKSGATDHANEEHYKSDGEPLRRHVSDESSIHATEDDHEEDEVGSKLQLGPQCTLKEHLEKDKDDESLRRWKEQLLGSVDVNNVAEILDPEVTITCLTIISPDRDDIVLPIPENGTPKGLWFTLKEGSHYRLKFTFHVSNNIVSGLKYTNTVWKTAVKVDSSKEMLGTFSPQAEPYTHEMPEETTPSGLFARGSYSARSKFLDDDNKCYLEINYTFDIRKEWA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain