SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g46930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g46930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g46930

Feature Type:gene_model
Chromosome:Gm02
Start:50731629
stop:50734918
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G55630AT Annotation by Michelle Graham. TAIR10: Outward rectifying potassium channel protein | chr5:22531718-22532893 FORWARD LENGTH=363 SoyBaseE_val: 4.00E-148ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0010029GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed germination SoyBaseN/AISS
GO:0010119GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement SoyBaseN/AISS
GO:0030003GO-bp Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis SoyBaseN/AISS
GO:0030007GO-bp Annotation by Michelle Graham. GO Biological Process: cellular potassium ion homeostasis SoyBaseN/AISS
GO:0051260GO-bp Annotation by Michelle Graham. GO Biological Process: protein homooligomerization SoyBaseN/AISS
GO:0070838GO-bp Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport SoyBaseN/AISS
GO:0071805GO-bp Annotation by Michelle Graham. GO Biological Process: potassium ion transmembrane transport SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005216GO-mf Annotation by Michelle Graham. GO Molecular Function: ion channel activity SoyBaseN/AISS
GO:0005267GO-mf Annotation by Michelle Graham. GO Molecular Function: potassium channel activity SoyBaseN/AISS
GO:0015269GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium-activated potassium channel activity SoyBaseN/AISS
GO:0015271GO-mf Annotation by Michelle Graham. GO Molecular Function: outward rectifier potassium channel activity SoyBaseN/AISS
PTHR11003Panther POTASSIUM CHANNEL, SUBFAMILY K JGI ISS
PTHR11003:SF5Panther POTASSIUM CHANNEL PROTEIN JGI ISS
PF07885PFAM Ion channel JGI ISS
UniRef100_G7K4P7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Outward rectifying potassium channel n=1 Tax=Medicago truncatula RepID=G7K4P7_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1JJJ2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JJJ2_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g46930 not represented in the dataset

Glyma02g46930 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma14g01790 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g299700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g46930.1   sequence type=CDS   gene model=Glyma02g46930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAACAATGGTGCAAAGGATCCCTTGCTGTCAGGATCACTTGATGCGACTCAAAAGACTAAACAGCAGTTATTAAACAAGAGAAGGCTCCTCCGTTCTAGAAGTGCTCCTCACGCAGAGCTTGTTCCTACAGAGACAAATTGCAATGAATCAATTCCTCGTACTGCATCCATATTTCAGAATTTGCATCCAAGTTTTAAAAGAATGGCTATCTACCTTGCAGTCTATTTAGGTGTAGGTGCTTTAATCTTCTACCTTGTCAGAAACCAGATTAAGGGGCAGAAAACAGATGGAATTCTTGATGCTTTATACTTCACAATTGTGACAATGACCACTGTTGGATATGGAGACCTTGTGCCAAATAGCCACCTTGCAAAACTACTTGCATGTGCTTTTGTTTTCTCTGGGATGGCATTGATTGGACTAATTGTAAGCAAAGCAGCAGACTACTTAGTTGAGAAACAAGAACTTTTGCTAGTTAAAGCCATGCGCATGCACCAAAAAATTGGTTCAACTGAAATTTTAAGGGAGGTTGAGACCAATAAAACAAGATACAAATTATTTCTAGTCTTTTCCCTTCTTTTGATTCTCATCATCGTGGGGACAATTTTTTTGGTCACAGTTGAGAAATTGGATGTTATAGATGCATTCTACTGTGTTTGTTCTACAATTACAACACTGGGTTATGGGGATCAAAGTTTCTCAACTCAAGCAGGAAGAATATTTGCTGTGTTTTGGATATTGACAGGTACTATTACTTTAGCTCAGCTTTTCGTCTACATTGCTGAACTAAACACTGAAATCAGACAAAAGGAACTTGTCAAGTGGGTACTTACAAGGAAAGTGACCAATTTAGATTTGGAGGCTGCAGATCTTGATGAGGATGGGACTGTTGGGGCTGCGGAATTCGTTATTTATAAGCTCAAAGAGATGGGGAAGATTAGTCAAGAAGATATATCACTTGTGATGCAGGAGTTTGAACAGCTTGATGTTGATGATTCTGGCACACTATCAACTTCGGATATAACACTTGCTCAGTCATCTTAG

>Glyma02g46930.1   sequence type=predicted peptide   gene model=Glyma02g46930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANNGAKDPLLSGSLDATQKTKQQLLNKRRLLRSRSAPHAELVPTETNCNESIPRTASIFQNLHPSFKRMAIYLAVYLGVGALIFYLVRNQIKGQKTDGILDALYFTIVTMTTVGYGDLVPNSHLAKLLACAFVFSGMALIGLIVSKAADYLVEKQELLLVKAMRMHQKIGSTEILREVETNKTRYKLFLVFSLLLILIIVGTIFLVTVEKLDVIDAFYCVCSTITTLGYGDQSFSTQAGRIFAVFWILTGTITLAQLFVYIAELNTEIRQKELVKWVLTRKVTNLDLEAADLDEDGTVGAAEFVIYKLKEMGKISQEDISLVMQEFEQLDVDDSGTLSTSDITLAQSS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo