|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G07430 | AT | Annotation by Michelle Graham. TAIR10: highly ABA-induced PP2C gene 2 | chr1:2281151-2282656 REVERSE LENGTH=442 | SoyBase | E_val: 5.00E-26 | ISS |
| GO:0006470 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein dephosphorylation | SoyBase | N/A | ISS |
| GO:0009738 | GO-bp | Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0008287 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: protein serine/threonine phosphatase complex | SoyBase | N/A | ISS |
| GO:0003824 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: catalytic activity | SoyBase | N/A | ISS |
| GO:0004722 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity | SoyBase | N/A | ISS |
| PTHR13832 | Panther | PROTEIN PHOSPHATASE 2C | JGI | ISS | |
| PTHR13832:SF115 | Panther | SUBFAMILY NOT NAMED | JGI | ISS | |
| PF00481 | PFAM | Protein phosphatase 2C | JGI | ISS | |
| UniRef100_G7KGU9 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Protein phosphatase 2C n=1 Tax=Medicago truncatula RepID=G7KGU9_MEDTR | SoyBase | E_val: 2.00E-28 | ISS |
| UniRef100_UPI00018C6F16 | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI00018C6F16 related cluster n=1 Tax=unknown RepID=UPI00018C6F16 | SoyBase | E_val: 7.00E-39 | ISS |
|
Glyma02g44631 not represented in the dataset |
Glyma02g44631 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.02g278100 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma02g44631.1 sequence type=CDS gene model=Glyma02g44631 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGAGAATAGATTCGCTCGCATGGACAACGAGGTTAATCGCAGGAGCCAGAGCAACCAGACCTTCACGTGCAGGTGCGAGCTCCAGACTCCCCACTACGATGTCGTCAGATCCACTGCTGTCGTTGCCATCGTCACGTCGGACAAACTCGTCGTTTCCAACTGCGGCGACTCCCGCGCCGTTCTTTGCCGGAAAGGCGTAGCCATCCCTCTCTCCTACGATCACAAGAAATCTTCAGGATTATTCTACAAGAATCCATTCTTCACTTTGAAGATCTCTACACTATTTTTATTACAAGATCTCTGCAAGATCAGATCTTGA
>Glyma02g44631.1 sequence type=predicted peptide gene model=Glyma02g44631 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MENRFARMDNEVNRRSQSNQTFTCRCELQTPHYDVVRSTAVVAIVTSDKLVVSNCGDSRAVLCRKGVAIPLSYDHKKSSGLFYKNPFFTLKISTLFLLQDLCKIRS*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||