SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g43416): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g43416): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g43416

Feature Type:gene_model
Chromosome:Gm02
Start:48188517
stop:48189456
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G01120AT Annotation by Michelle Graham. TAIR10: 3-ketoacyl-CoA synthase 1 | chr1:57392-58978 REVERSE LENGTH=528 SoyBaseE_val: 1.00E-57ISS
GO:0000038GO-bp Annotation by Michelle Graham. GO Biological Process: very long-chain fatty acid metabolic process SoyBaseN/AISS
GO:0006633GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0008610GO-bp Annotation by Michelle Graham. GO Biological Process: lipid biosynthetic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009805GO-bp Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process SoyBaseN/AISS
GO:0010025GO-bp Annotation by Michelle Graham. GO Biological Process: wax biosynthetic process SoyBaseN/AISS
GO:0030497GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid elongation SoyBaseN/AISS
GO:0042335GO-bp Annotation by Michelle Graham. GO Biological Process: cuticle development SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0009922GO-mf Annotation by Michelle Graham. GO Molecular Function: fatty acid elongase activity SoyBaseN/AISS
GO:0016746GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring acyl groups SoyBaseN/AISS
GO:0016747GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring acyl groups other than amino-acyl groups SoyBaseN/AISS
PF08392PFAM FAE1/Type III polyketide synthase-like protein JGI ISS
UniRef100_I1JS32UniRef Annotation by Michelle Graham. Most informative UniRef hit: 3-ketoacyl-CoA synthase n=1 Tax=Glycine max RepID=I1JS32_SOYBN SoyBaseE_val: 6.00E-72ISS
UniRef100_I1JS32UniRef Annotation by Michelle Graham. Best UniRef hit: 3-ketoacyl-CoA synthase n=1 Tax=Glycine max RepID=I1JS32_SOYBN SoyBaseE_val: 6.00E-72ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g43416 not represented in the dataset

Glyma02g43416 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g266400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g43416.1   sequence type=CDS   gene model=Glyma02g43416   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGTGGCTTCGACGGTGCTCCTCTCCTTGGGCGCTTTGTACCGGTGGAAACGCTCCCCGACGGTGTACCTGGTGGACTTCGCGTGCTACAAGCCGAAGAAAGAACACAAAATATCGATGGAAGGATTTCTAAAGATGACCAAAGAGAGTGAGGGGTTCGAGGAAGAGTCTCTCCAATTCCAGAGGAAGATTTCCACAAGGACGGGTTTGGGCGACAAGACCTACCTTCCCAGAGGAATCACTTCTTGCCCGCCCAAGCTTTGCATGAACGAAGTGCATCTAGAGGAAAACATCGTCATGTTCAATGCCCTGGATGCTCTTTTGGCCAAAACGGGGATTGATCCGAAGGACATTGACATTCCGGTGGTGAATTGTGGTTTGTTCAACCCAACACCATCTCTCTCGGCCATGATTGTGAACCACTATAGGCTGAGAAGCAACATAAAGAGCTACAACACTCGCAGCCACACTGTTTCTGATGATGAGCATTACTTTCCACAAATTCTAGATGTTCAATTCTAA

>Glyma02g43416.1   sequence type=predicted peptide   gene model=Glyma02g43416   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVASTVLLSLGALYRWKRSPTVYLVDFACYKPKKEHKISMEGFLKMTKESEGFEEESLQFQRKISTRTGLGDKTYLPRGITSCPPKLCMNEVHLEENIVMFNALDALLAKTGIDPKDIDIPVVNCGLFNPTPSLSAMIVNHYRLRSNIKSYNTRSHTVSDDEHYFPQILDVQF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo