SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma02g41865

Feature Type:gene_model
Chromosome:Gm02
Start:46949398
stop:46949838
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G38040AT Annotation by Michelle Graham. TAIR10: Exostosin family protein | chr4:17867501-17869131 FORWARD LENGTH=425 SoyBaseE_val: 2.00E-12ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
PF03016PFAM Exostosin family JGI ISS
UniRef100_G7K222UniRef Annotation by Michelle Graham. Most informative UniRef hit: Xylogalacturonan beta-1,3-xylosyltransferase n=1 Tax=Medicago truncatula RepID=G7K222_MEDTR SoyBaseE_val: 5.00E-39ISS
UniRef100_G7K222UniRef Annotation by Michelle Graham. Best UniRef hit: Xylogalacturonan beta-1,3-xylosyltransferase n=1 Tax=Medicago truncatula RepID=G7K222_MEDTR SoyBaseE_val: 5.00E-39ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g41865 not represented in the dataset

Glyma02g41865 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g251300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g41865.1   sequence type=CDS   gene model=Glyma02g41865   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCACAAACACAAACGCAACACAATTACAATTCATCATCTCCTTACATCTCAACCGCCACGGTGTTTCTCAATTACGAGAAAATGGTTAAGAATTTCAAAGTGTTCATGTACAAGCCAAACAACCCCCAAATCAAATTCGCGACCACGAACAGCACCTACCTCACCCAAGATCCCGAGGAAGCGCACCTTTTCTTCGACCCTTTCTCCCCAGACTTCTCCACGCGTGTCCTTACACGCATCCGCAACGACCTCCCGTACTGGAACCGCACCCTCGGCGCCGACCACCTCTACCTTTCCTGCGACGGAATCCCCCTCCAACCGGACCGGAACCTGGTAGAATTGAAGAAAAACGCCGTTCAAATCTCGTGCTTCCCCACACAAGGACGTCACGCTGCCCCCGCTCCCTAG

>Glyma02g41865.1   sequence type=predicted peptide   gene model=Glyma02g41865   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSQTQTQHNYNSSSPYISTATVFLNYEKMVKNFKVFMYKPNNPQIKFATTNSTYLTQDPEEAHLFFDPFSPDFSTRVLTRIRNDLPYWNRTLGADHLYLSCDGIPLQPDRNLVELKKNAVQISCFPTQGRHAAPAP*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo