|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G38040 | AT | Annotation by Michelle Graham. TAIR10: Exostosin family protein | chr4:17867501-17869131 FORWARD LENGTH=425 | SoyBase | E_val: 2.00E-12 | ISS |
| GO:0008150 | GO-bp | Annotation by Michelle Graham. GO Biological Process: biological process | SoyBase | N/A | ISS |
| GO:0005768 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: endosome | SoyBase | N/A | ISS |
| GO:0005794 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus | SoyBase | N/A | ISS |
| GO:0005802 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0003824 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: catalytic activity | SoyBase | N/A | ISS |
| PF03016 | PFAM | Exostosin family | JGI | ISS | |
| UniRef100_G7K222 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Xylogalacturonan beta-1,3-xylosyltransferase n=1 Tax=Medicago truncatula RepID=G7K222_MEDTR | SoyBase | E_val: 5.00E-39 | ISS |
| UniRef100_G7K222 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Xylogalacturonan beta-1,3-xylosyltransferase n=1 Tax=Medicago truncatula RepID=G7K222_MEDTR | SoyBase | E_val: 5.00E-39 | ISS |
|
Glyma02g41865 not represented in the dataset |
Glyma02g41865 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.02g251300 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma02g41865.1 sequence type=CDS gene model=Glyma02g41865 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTCACAAACACAAACGCAACACAATTACAATTCATCATCTCCTTACATCTCAACCGCCACGGTGTTTCTCAATTACGAGAAAATGGTTAAGAATTTCAAAGTGTTCATGTACAAGCCAAACAACCCCCAAATCAAATTCGCGACCACGAACAGCACCTACCTCACCCAAGATCCCGAGGAAGCGCACCTTTTCTTCGACCCTTTCTCCCCAGACTTCTCCACGCGTGTCCTTACACGCATCCGCAACGACCTCCCGTACTGGAACCGCACCCTCGGCGCCGACCACCTCTACCTTTCCTGCGACGGAATCCCCCTCCAACCGGACCGGAACCTGGTAGAATTGAAGAAAAACGCCGTTCAAATCTCGTGCTTCCCCACACAAGGACGTCACGCTGCCCCCGCTCCCTAG
>Glyma02g41865.1 sequence type=predicted peptide gene model=Glyma02g41865 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MSQTQTQHNYNSSSPYISTATVFLNYEKMVKNFKVFMYKPNNPQIKFATTNSTYLTQDPEEAHLFFDPFSPDFSTRVLTRIRNDLPYWNRTLGADHLYLSCDGIPLQPDRNLVELKKNAVQISCFPTQGRHAAPAP*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||