SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g41120

Feature Type:gene_model
Chromosome:Gm02
Start:46274935
stop:46279352
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g41120
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G37600AT Annotation by Michelle Graham. TAIR10: glutamine synthase clone R1 | chr5:14933574-14935656 REVERSE LENGTH=356 SoyBaseE_val: 0ISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009749GO-bp Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0010150GO-bp Annotation by Michelle Graham. GO Biological Process: leaf senescence SoyBaseN/AISS
GO:0042128GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate assimilation SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004356GO-mf Annotation by Michelle Graham. GO Molecular Function: glutamate-ammonia ligase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0683 KOG Glutamine synthetase JGI ISS
PTHR20852Panther GLUTAMINE SYNTHETASE JGI ISS
PTHR20852:SF14Panther GLUTAMINE SYNTHETASE (GLUTAMATE--AMMONIA LIGASE) ( JGI ISS
PF00120PFAM Glutamine synthetase, catalytic domain JGI ISS
PF03951PFAM Glutamine synthetase, beta-Grasp domain JGI ISS
UniRef100_C6TCD2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glutamine synthetase n=1 Tax=Glycine max RepID=C6TCD2_SOYBN SoyBaseE_val: 0ISS
UniRef100_UPI00019D33F0UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00019D33F0 related cluster n=1 Tax=unknown RepID=UPI00019D33F0 SoyBaseE_val: 0ISS

Proteins Associated with Glyma02g41120
LocusGene SymbolProtein Name
GS-gamma2-a Gamma glutamine synthase 2 gene

Expression Patterns of Glyma02g41120
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g41120
ParalogEvidenceComments
Glyma14g39420 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g41120 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g244000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g41120
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g41120
>Glyma02g41120.1   sequence type=CDS   gene model=Glyma02g41120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGTTACTCTCCGATCTTATCAACCTTAACCTCTCCGACATCACCGATAAGGTGATCGCCGAGTACATATGGGTTGGTGGATCTGGCATGGATATGAGGAGCAAAGCAAGGACTCTCTCGGGACTGGTTAATGACCCTTCCAAGCTTCCCAAGTGGAACTATGATGGTTCCAGCACTGGTCAAGCTCCTGGACAAGATAGTGAAGTGATCTTATATCCACAAGCAATTTTTCGGGATCCATTCAGGAGGGGTAACAATATCCTGGTTATGTGTGATGCTTACACTCCTGCTGGGGAACCCATTCCTACCAACAAGAGAAATAAAGCTGCAAAGATATTCAGTAATCCGGATGTTGCTGCTGAAGAACCCTGGTATGGTCTTGAGCAGGAATATACATTATTGCAGAAAGATGTCCAATGGCCTCTTGGATGGCCTCTTGGTGGGTTTCCTGGGCCCCAGGGACCATACTATTGTGGAACTGGTGCTAACAAGGCTTTTGGGCGTGATATTGTTGACTCACATTACAAAGCATGTATTTATGCGGGAATTAACATAAGTGGAATCAATGGAGAAGTGATGCCCGGTCAGTGGGAATTCCAAGTTGGTCCATCGGTTGGCATCTCTGCTGCTGACGAGTTGTGGGTTGCTCGTTACATTTTGGAGAGGATCACCGAGATTGCTGGAGTGGTGCTTTCCTTTGACCCTAAACCAATTCAGGGTGATTGGAATGGTGCTGGTGCTCACACAAATTACAGTACCAAGTTGATGAGAAACGATGGTGGCTATGAAATCATCAAAAAAGCAATTGCTAAGTTGGAAAAGAGGCACAAAGAGCACATTGCTGCTTACGGAGAAGGCAATGAACGTCGTTTGACCGGACGACACGAGACGGCTGACATGAACACCTTTTTATGGGGTGTTGCAAACCGTGGTGCTTCTATTAGGGTAGGGAGAGACACTGAAAAGGCAGGGAAGGGATACTTTGAAGATAGGAGGCCTGCCTCTAACATGGACCCTTATGTGGTCACTTCCATGATTGCTGAGACAACTATTCTTTGGAAACCATAA
Predicted protein sequences of Glyma02g41120
>Glyma02g41120.1   sequence type=predicted peptide   gene model=Glyma02g41120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSLLSDLINLNLSDITDKVIAEYIWVGGSGMDMRSKARTLSGLVNDPSKLPKWNYDGSSTGQAPGQDSEVILYPQAIFRDPFRRGNNILVMCDAYTPAGEPIPTNKRNKAAKIFSNPDVAAEEPWYGLEQEYTLLQKDVQWPLGWPLGGFPGPQGPYYCGTGANKAFGRDIVDSHYKACIYAGINISGINGEVMPGQWEFQVGPSVGISAADELWVARYILERITEIAGVVLSFDPKPIQGDWNGAGAHTNYSTKLMRNDGGYEIIKKAIAKLEKRHKEHIAAYGEGNERRLTGRHETADMNTFLWGVANRGASIRVGRDTEKAGKGYFEDRRPASNMDPYVVTSMIAETTILWKP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo