SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g40760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g40760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g40760

Feature Type:gene_model
Chromosome:Gm02
Start:45983829
stop:45984903
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G78380AT Annotation by Michelle Graham. TAIR10: glutathione S-transferase TAU 19 | chr1:29486659-29487819 REVERSE LENGTH=219 SoyBaseE_val: 1.00E-84ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0010583GO-bp Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0042631GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to water deprivation SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0004364GO-mf Annotation by Michelle Graham. GO Molecular Function: glutathione transferase activity SoyBaseN/AISS
GO:0043295GO-mf Annotation by Michelle Graham. GO Molecular Function: glutathione binding SoyBaseN/AISS
KOG0406 KOG Glutathione S-transferase JGI ISS
PTHR11260Panther GLUTATHIONE S-TRANSFERASE, GST, SUPERFAMILY, GST DOMAIN CONTAINING JGI ISS
PTHR11260:SF54Panther SUBFAMILY NOT NAMED JGI ISS
PF00043PFAM Glutathione S-transferase, C-terminal domain JGI ISS
PF02798PFAM Glutathione S-transferase, N-terminal domain JGI ISS
UniRef100_I1JHR9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JHR9_SOYBN SoyBaseE_val: 7.00E-159ISS
UniRef100_Q8H1Y6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glutathione S-transferase n=1 Tax=Medicago truncatula RepID=Q8H1Y6_MEDTR SoyBaseE_val: 5.00E-137ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g40760 not represented in the dataset

Glyma02g40760 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma14g39090 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g240600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g40760.1   sequence type=CDS   gene model=Glyma02g40760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCAAAGGGTGACAAGGTTGAGGTTTTGGACTTTTGGGCTAGCCCATTTTGTGCAAGAGTGAAAGTTGCTTTGGAAGAGAAGGGGGTGAATTATGTAGCCAGTGAAGAGGATTTGTTTGGAGGCAAGAGTGAGCTTCTCCTTAAGTCAAATCCTATTCATCAAAAAGTTCCTGTGCTCTTGCACAATGACAAGCCTCTAGCCGAGTCTTCTATCATTGTTAGCTACATTGATGAAGTCTGGTCTTCCAACCCACTGCTTCCAACTCTTGCTTATGATCGTGCACAAGCCAGATTCTGGACTGATTACATTGACAAAAAGGTATTTGAAACCGGGAGGAGTATCTGGGGAAGCAATGGAGAAGAGAGAGAAGTGGGCACTAGGGACTTCATTGAAGTTTTAAAGCATCTTGAGGAAGCTCTAGGGGAGAAGGACTACTTTGGAGGTGATGCCTTTGGTTATGTTGACATCATAGCCATTGGTCATTCAGCTTGGTTTTTGGCCTATGAGAAGCTTGGTGGCTTCAAAGTTGAAGACCACTCGCCAAAAATCTCAGCTTGGATTAAGAGGAGCTTGCAAAGGGAATCTGTTGCCAAAGTTCTGCCAGACCCTGAGAAGGTCTACCAGTTTGTCCTTCATTTCAGGAAGATGTTAGGACTTGAATAA

>Glyma02g40760.1   sequence type=predicted peptide   gene model=Glyma02g40760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSKGDKVEVLDFWASPFCARVKVALEEKGVNYVASEEDLFGGKSELLLKSNPIHQKVPVLLHNDKPLAESSIIVSYIDEVWSSNPLLPTLAYDRAQARFWTDYIDKKVFETGRSIWGSNGEEREVGTRDFIEVLKHLEEALGEKDYFGGDAFGYVDIIAIGHSAWFLAYEKLGGFKVEDHSPKISAWIKRSLQRESVAKVLPDPEKVYQFVLHFRKMLGLE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo