SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g40590): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g40590): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g40590

Feature Type:gene_model
Chromosome:Gm02
Start:45832172
stop:45838437
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G02680AT Annotation by Michelle Graham. TAIR10: nijmegen breakage syndrome 1 | chr3:576378-579226 FORWARD LENGTH=542 SoyBaseE_val: 1.00E-130ISS
GO:0000003GO-bp Annotation by Michelle Graham. GO Biological Process: reproduction SoyBaseN/AISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006259GO-bp Annotation by Michelle Graham. GO Biological Process: DNA metabolic process SoyBaseN/AISS
GO:0006302GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair SoyBaseN/AISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006325GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin organization SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007059GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome segregation SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007140GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0032504GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PTHR12162Panther NIBRIN-RELATED JGI ISS
PF00498PFAM FHA domain JGI ISS
UniRef100_G7K5Y3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nibrin n=1 Tax=Medicago truncatula RepID=G7K5Y3_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1JHQ4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1JHQ4_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g40590 not represented in the dataset

Glyma02g40590 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma14g38900 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g239200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g40590.1   sequence type=CDS   gene model=Glyma02g40590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGTTGTGATGTAATAATCACTAAAGATAAAGGGGTTTCTAGGGTTCACGCAGAAATAGTTGTTAATACAATGAACCCGGTAAATCCTTTACCAAATGAACGTTCTCATTTGTCACACAGTATACATATTAGAGATTGCTCCAAGTATGGGACATTTATTAGCAAGAATGATGGGGCCAAGAAAAAAGTTCATGAGCTACCAAACAAAGATACAGCATTAGAGGATGGTGACCTTGTTTCTTTTGGCACTGGTACTGCTACCTACAAGTTTTGCCATGTACCCCTCGTTTTTTTCATCTGTTCCTCAAATAAAGTGGATCGATCCCTTGAAGAGAAAATTTCATCAATTGGTGCTGGTATTACTCATACCTTAGGTGAAGGGTGCACACATGTGCTGGTGGATCAACTCATGCCATTGAAGAAGGATCTTGTTGATGCTGTTGTGACCAAAAAATCTTGTGTTCTCAAAAATTGGCTTGAGTTTTTTGCAAAAAAGAACATTAGCACTGAAATTCCTAGCTGTCATTCATATATTCCAACAGTGTCAGTGGAAGGAGAATCTATTAAAATTGCTGACCCCAGAATGCGTGAAGATTGCTTGAAAGGATACACTTTTTTGTTGGAATCTGAGCATTTGTATAAGTTTGGGGATCAGCTAAAACCTTTATTGGAAGTGGCTGGTGCAAAAGTTGTTTCCTCTGAAGATTTTTGTTCAGATAGCCAAGGTACAGATTATGGAGAGGATAATCGTGTGGTGTGTGTCATCCCAGGAGGACCAGCATGCAAGTCTAATCTCTTCAATAAACTAAGTTCATTGCTTAGAGTGACTGAGATGGATGTAATATGTGCTGCTTTCAGTGGACAGTTAGATCTGTCTATTTTGAAATCACCATGCTTACTAGTTTCATCATCATGCTCTACAGATGAGACGATTGTAGCAGATTCAGATACTGAAGTTGAAACAGCCACACCAGCCCCCTCAAATGATGCATTCAGCAATGGCAATAATGTAAAATATGGAAAAACAGAAGAATTATATGATGATTCTGACCCTTTGGATAAGAGAAAACATGAAAGAATAGAGGCATCCTCAGATGATGTTTCAACCAGATTGCATGACATTAAACATGCAAAAACTGAAACATCCTTGGATGGTGCTTCTGCCAGATCACATTCTACCAGCTTCAGGAATGCTAATGATGGTATCAAAATAAAGAAAGGCATGGTTGATGATTATGAAAGTGGAAATTCAGATATGGTTTACAGCCAATATTTAGTTGTTCGAGATACAAACATTTGTACTATCATAAGTACTGCACCAAACAGCAGTGTTCCAAATTTTAAACACTTCAGAAAGGCACAAACTCAATCCGGTAATAGCTTTGACAATCTTGTTCCATTTGGAAAATATCCATACAAGGACTCTGACTGTGGGAACGAGGATGTGACTGAGCTTGTGAAGAAGGAGAAAAGGCAAAAGAAAATGGAAGCTATGGCAGATGACATGTTTCATAATGAGGCAAGAAAACGAGGCACTGTTGGTTCTCTTCGTGGCATTCTTACTTCATGA

>Glyma02g40590.1   sequence type=predicted peptide   gene model=Glyma02g40590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCDVIITKDKGVSRVHAEIVVNTMNPVNPLPNERSHLSHSIHIRDCSKYGTFISKNDGAKKKVHELPNKDTALEDGDLVSFGTGTATYKFCHVPLVFFICSSNKVDRSLEEKISSIGAGITHTLGEGCTHVLVDQLMPLKKDLVDAVVTKKSCVLKNWLEFFAKKNISTEIPSCHSYIPTVSVEGESIKIADPRMREDCLKGYTFLLESEHLYKFGDQLKPLLEVAGAKVVSSEDFCSDSQGTDYGEDNRVVCVIPGGPACKSNLFNKLSSLLRVTEMDVICAAFSGQLDLSILKSPCLLVSSSCSTDETIVADSDTEVETATPAPSNDAFSNGNNVKYGKTEELYDDSDPLDKRKHERIEASSDDVSTRLHDIKHAKTETSLDGASARSHSTSFRNANDGIKIKKGMVDDYESGNSDMVYSQYLVVRDTNICTIISTAPNSSVPNFKHFRKAQTQSGNSFDNLVPFGKYPYKDSDCGNEDVTELVKKEKRQKKMEAMADDMFHNEARKRGTVGSLRGILTS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo