SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g38310

Feature Type:gene_model
Chromosome:Gm02
Start:43743802
stop:43747128
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g38310
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G40690AT Annotation by Michelle Graham. TAIR10: NAD-dependent glycerol-3-phosphate dehydrogenase family protein | chr2:16974107-16976241 FORWARD LENGTH=420 SoyBaseE_val: 0ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006072GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol-3-phosphate metabolic process SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0045017GO-bp Annotation by Michelle Graham. GO Biological Process: glycerolipid biosynthetic process SoyBaseN/AISS
GO:0046168GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol-3-phosphate catabolic process SoyBaseN/AISS
GO:0046486GO-bp Annotation by Michelle Graham. GO Biological Process: glycerolipid metabolic process SoyBaseN/AISS
GO:0048653GO-bp Annotation by Michelle Graham. GO Biological Process: anther development SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009331GO-cc Annotation by Michelle Graham. GO Cellular Compartment: glycerol-3-phosphate dehydrogenase complex SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004367GO-mf Annotation by Michelle Graham. GO Molecular Function: glycerol-3-phosphate dehydrogenase [NAD+] activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016614GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on CH-OH group of donors SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0050662GO-mf Annotation by Michelle Graham. GO Molecular Function: coenzyme binding SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG2711 KOG Glycerol-3-phosphate dehydrogenase/dihydroxyacetone 3-phosphate reductase JGI ISS
PTHR11728Panther GLYCEROL-3-PHOSPHATE DEHYDROGENASE JGI ISS
PF01210PFAM NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus JGI ISS
PF07479PFAM NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus JGI ISS
UniRef100_G7K638UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycerol-3-phosphate dehydrogenase n=1 Tax=Medicago truncatula RepID=G7K638_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1JH49UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JH49_SOYBN SoyBaseE_val: 0ISS

Proteins Associated with Glyma02g38310
LocusGene SymbolProtein Name
G3pdh Glycerol-3-phosphate dehydrogenase

Expression Patterns of Glyma02g38310
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g38310 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g218700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g38310
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g38310
>Glyma02g38310.1   sequence type=CDS   gene model=Glyma02g38310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCATTGTCAGAAGCGCCATTCTTTTCTTCAAAGCCTCACAGCACTAATCTCCCTCCCACCAAGTTTCACACTTTCCCCTCAAAACCCATCTCTCTCACCTTTCGCAGTACGTATACTCCTTGTTTCGCAAATGCTTCTCCTTCTCTTCCTCAAGACCCGGACCCGGGAACCGACTCCGACCCTGACCCGACCCGAGACCGCCGGAGAATCGTTCGGGTCGCCTGGGAGAAGATCGTACGCTGGTCCAGGTCTTGGCGCTCCAAGGCCAACACCGACGTCCTCCAACGCACAAATAAGGTGGTTGTACTTGGAGGAGGGTCATTTGGGACGGCAATGGCTGCCCATGTGGCAAATAGGAAGGCTGAGTTAGAGGTGATCATGCTTGTTCGGGACCCTCAAGTTTGCTTGTCTATCAATGAGAGGCACTGTAATTGTAAGTACTTCCCGGATCATAGGCTGCCGGAAAATGTAGTTGCAACAATGGATGCCAAGTCTGCTTTGCTTGGTGCTGATTACTGCCTCCATGCAGTGCCTGTTCAGTTCAGCGCATCTTTTCTCGAGAGTGTTGCCGAGTATGTTGATCCAGGGTTGCCATTCATATCTCTCAGTAAAGGCCTAGAGTTGAATACTCTGAGGATGATGGCTCAAATTATTCCTCATGCACTACGGAATCCTCGCCAGCCTTTTGTTGCACTATCAGGGCCTTCTTTTGCTCTGGAATTGATGGATAAGCTACCCACAGCAATGGTGGTGGCATCAAAAGACAAAAAATTGGCTAATACTGTTCAGCAACTACTTGCTTCAAGTCATTTAAGAATCAGCACATCAAGTGATGTTACAGGAGTTGAAATAGCAGGTGCACTCAAGAACGTGCTTGCAATAGCAGCTGGGATAGTAGAAGGTATGAATCTTGGTAACAACTCAATGGCTGCTCTTGTCTCGCAAGGCTGTTCAGAGATACGGTGGCTTGCAACAAAGATGGGTGCAAAGCCGACTACTATAACAGGGCTGTCAGGAACTGGAGACATAATGCTTACATGTTTCGTGAATCTTTCAAGAAACAGAACAGTTGGTGTGCGACTAGGATCAGGCGAGAAGCTTGAGAACATACTTAGTTCCATGAATCAGGTAGCAGAAGGTGTCTCCACCGCCGGGGCTGTGATTGCTTTGGCGCAGAAATATAATGTAAAGCTGCCAGTCTTGACAGCAGTTGCTCGTATTATCGACAATGAACTTACCCCTAAGAAAGCTGTTTTTGAGTTAATGAGCCTCCCTCAGGTTGAAGAAGTATGA
Predicted protein sequences of Glyma02g38310
>Glyma02g38310.1   sequence type=predicted peptide   gene model=Glyma02g38310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAALSEAPFFSSKPHSTNLPPTKFHTFPSKPISLTFRSTYTPCFANASPSLPQDPDPGTDSDPDPTRDRRRIVRVAWEKIVRWSRSWRSKANTDVLQRTNKVVVLGGGSFGTAMAAHVANRKAELEVIMLVRDPQVCLSINERHCNCKYFPDHRLPENVVATMDAKSALLGADYCLHAVPVQFSASFLESVAEYVDPGLPFISLSKGLELNTLRMMAQIIPHALRNPRQPFVALSGPSFALELMDKLPTAMVVASKDKKLANTVQQLLASSHLRISTSSDVTGVEIAGALKNVLAIAAGIVEGMNLGNNSMAALVSQGCSEIRWLATKMGAKPTTITGLSGTGDIMLTCFVNLSRNRTVGVRLGSGEKLENILSSMNQVAEGVSTAGAVIALAQKYNVKLPVLTAVARIIDNELTPKKAVFELMSLPQVEEV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo