Glyma02g37980 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g37980

Feature Type:	gene_model
Chromosome:	Gm02
Start:	43271674
stop:	43276335
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g37980

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G24470	AT	Annotation by Michelle Graham. TAIR10: GATA-type zinc finger protein with TIFY domain \| chr4:12645785-12647734 FORWARD LENGTH=309	SoyBase	E_val: 1.00E-86	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007623	GO-bp	Annotation by Michelle Graham. GO Biological Process: circadian rhythm	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF00320	PFAM	GATA zinc finger	JGI		ISS
PF06200	PFAM	tify domain	JGI		ISS
PF06203	PFAM	CCT motif	JGI		ISS
UniRef100_G7JYF5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: GATA transcription factor n=1 Tax=Medicago truncatula RepID=G7JYF5_MEDTR	SoyBase	E_val: 6.00E-115	ISS
UniRef100_UPI000233742F	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233742F related cluster n=1 Tax=unknown RepID=UPI000233742F	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma02g37980

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g37980

Paralog	Evidence	Comments
Glyma14g36150	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g37980 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g215600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g37980

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g37980

Limit To All Plant Sequences

>Glyma02g37980.2   sequence type=CDS   gene model=Glyma02g37980   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGCCATCAGCAATGTACGGACCCTCCCAGCCCCTGAACATCCCCTCGCGGATCGGCGCTGGCGAAAGAGACGACGGCTCCGGCAACGAGCCCGCCGTCGACGGCCACCACCACCACATTCAGTACGAAACGCACGCGCTCGATGACGGTGCCGCCGGTGGCGCCGTGGTTGTCGAGGATGTTACGTCGGACGCGGTCTATGTCTCCGGCGGTGGAGGCCCCGAGGAGTCCAGCCAGCTTACGCTGTCGTTTCGTGGCCAAGTTTACGTCTTCGATGCCGTTACGCCTGATAAGGTTCAAGCGGTGTTGTTACTTTTGGGTGGATGTGAACTATCTTCGGGTGGTTCGCCATGTGTGGATCCTGGGGCTCAACAGAATCAAAGGGGTTCAATGGAATTTCCTAAATGTAGTCTACCACAACGAGCTGCCTCATTAGATAGGTTCAGGCAGAAGAGGAAAGAGCGATGCTTTGATAAAAAAGTGAGATATAGCGTACGGCAAGAAGTTGCGCTCAGGATGCATCGTAACAAGGGTCAGTTTACTTCATCTAAGAAACAAGATGGAGCTAATAGTTATGGTACTGACCAAGATTCAGGACAGGATGATAGTCAATCTGAAACCTCATGTAAACATTGTGGCACTAGTTCAAAATCCACCCCAATGATGCGGCGAGGGCCATCTGGTCCAAGGTCACTTTGCAATGCTTGTGGGCTTTTTTGGGCAAATAGGGGTGCTTTGAGAGACCTTTCTAAGAGAAATCAGGAACACTCTCTTCCACCAGTTGAACAGGTTGATGGAGGTAATGACCCAGACTGTCGGACTGCCGCTGCCGACCCTGCACAAAACAATCTTGCTGCTTTCTCAGAGCCTGTTAATCCAGCTTTGGTAGCTGATCGTAAGGTTTTCCAATCTCAGAAAATGTTGGAGTAG

Predicted protein sequences of Glyma02g37980

Limit To All Plant Sequences

>Glyma02g37980.2   sequence type=predicted peptide   gene model=Glyma02g37980   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEPSAMYGPSQPLNIPSRIGAGERDDGSGNEPAVDGHHHHIQYETHALDDGAAGGAVVVEDVTSDAVYVSGGGGPEESSQLTLSFRGQVYVFDAVTPDKVQAVLLLLGGCELSSGGSPCVDPGAQQNQRGSMEFPKCSLPQRAASLDRFRQKRKERCFDKKVRYSVRQEVALRMHRNKGQFTSSKKQDGANSYGTDQDSGQDDSQSETSCKHCGTSSKSTPMMRRGPSGPRSLCNACGLFWANRGALRDLSKRNQEHSLPPVEQVDGGNDPDCRTAAADPAQNNLAAFSEPVNPALVADRKVFQSQKMLE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain