Glyma02g37150 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g37150

Feature Type:	gene_model
Chromosome:	Gm02
Start:	42484612
stop:	42489728
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g37150

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G22450	AT	Annotation by Michelle Graham. TAIR10: cytochrome C oxidase 6B \| chr1:7925447-7926918 FORWARD LENGTH=191	SoyBase	E_val: 3.00E-58	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009853	GO-bp	Annotation by Michelle Graham. GO Biological Process: photorespiration	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009535	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane	SoyBase	N/A	ISS
GO:0009579	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: thylakoid	SoyBase	N/A	ISS
GO:0004129	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cytochrome-c oxidase activity	SoyBase	N/A	ISS
GO:0005507	GO-mf	Annotation by Michelle Graham. GO Molecular Function: copper ion binding	SoyBase	N/A	ISS
KOG3057	KOG	Cytochrome c oxidase, subunit VIb/COX12	JGI		ISS
PTHR11387	Panther	CYTOCHROME C OXIDASE POLYPEPTIDE VIB	JGI		ISS
PF02297	PFAM	Cytochrome oxidase c subunit VIb	JGI		ISS
UniRef100_G7KAG6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Subunit 6b of cytochrome c oxidase n=1 Tax=Medicago truncatula RepID=G7KAG6_MEDTR	SoyBase	E_val: 3.00E-82	ISS
UniRef100_I1JGV5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JGV5_SOYBN	SoyBase	E_val: 1.00E-121	ISS

Expression Patterns of Glyma02g37150

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g37150

Paralog	Evidence	Comments
Glyma14g35430	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Glyma17g07710	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g37150 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g208900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g37150

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g37150

Limit To All Plant Sequences

>Glyma02g37150.1   sequence type=CDS   gene model=Glyma02g37150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGAAACTGCTGACAAATCTCAATCTCTCGCCGAGGAATATTATGTGAATGACAAGCAAACAACTGTAGTTGAAAAAGCTGTTGAGGTCAAAGAAGTTGAAAACCCAAAGGTAGCTGCTTCTGAGGAACCAGTTGCTGAGAAAACTGTGGAAGAAACAACTCCTGTTGCCCCTGCAGTTGCTCAGGAAAGCAGTGAAGTCACCCCTCCTCCTGCTGAAGAAAGCACTGAAGAGCAAAGTAGTGGAAATGTTGAGGAAAACTCTGGCAATGAAGATGTAGCTGAAGAGACCCCTGAAATTAAGCTTGAAACTGCTCCAGCAGATTTCCGTTTTCCAACTACAAATCAAACCAGGCATTGCTTTACCCGATACATTGAATATCATCGATGTGTAGCTGCTAAAGGAGAAGGTGCACCAGAATGTGACAAGTTTGCCAAATATTATCGTTCTCTTTGCCCTGGTGAATGGGTTGACAGATGGAATGAGCAAAGGGAGAATGGAACATTCCCAGGCCCGCTGTAG

Predicted protein sequences of Glyma02g37150

Limit To All Plant Sequences

>Glyma02g37150.1   sequence type=predicted peptide   gene model=Glyma02g37150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAETADKSQSLAEEYYVNDKQTTVVEKAVEVKEVENPKVAASEEPVAEKTVEETTPVAPAVAQESSEVTPPPAEESTEEQSSGNVEENSGNEDVAEETPEIKLETAPADFRFPTTNQTRHCFTRYIEYHRCVAAKGEGAPECDKFAKYYRSLCPGEWVDRWNEQRENGTFPGPL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain