SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g37120

Feature Type:gene_model
Chromosome:Gm02
Start:42460276
stop:42462781
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g37120
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G78300AT Annotation by Michelle Graham. TAIR10: general regulatory factor 2 | chr1:29461883-29463052 FORWARD LENGTH=259 SoyBaseE_val: 1.00E-165ISS
GO:0009742GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid mediated signaling pathway SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0019904GO-mf Annotation by Michelle Graham. GO Molecular Function: protein domain specific binding SoyBaseN/AISS
GO:0045309GO-mf Annotation by Michelle Graham. GO Molecular Function: protein phosphorylated amino acid binding SoyBaseN/AISS
KOG0841 KOG Multifunctional chaperone (14-3-3 family) JGI ISS
PTHR18860Panther 14-3-3 JGI ISS
PF00244PFAM 14-3-3 protein JGI ISS
UniRef100_A5YM78UniRef Annotation by Michelle Graham. Most informative UniRef hit: 14-3-3-like protein n=1 Tax=Cicer arietinum RepID=A5YM78_CICAR SoyBaseE_val: 1.00E-177ISS
UniRef100_C6TGW2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TGW2_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma02g37120
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g37120
ParalogEvidenceComments
Glyma14g35410 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g37120 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g208700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g37120
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g37120
>Glyma02g37120.1   sequence type=CDS   gene model=Glyma02g37120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGCGAGCGCTCCCACTCCACGCGAAGAGTTCGTGTACATGGCGAAGCTGGCGGAGCAGGCCGAGCGCTACGAGGAGATGGTGGAGTTCATGGAGAAGGTCTCCGCCTCCGCCGAGAGCGAGGAGCTGACCGTGGAGGAGCGCAACCTCCTCTCCGTCGCCTACAAGAACGTAATCGGCGCTCGCCGCGCCTCCTGGCGCATCATCTCCTCCATTGAGCAGAAGGAGGAGAGCCGCGGCAACGAGGACCACGTCGCCGTCATCCGTGACTACCGCTCCAAGATCGAGGCCGAGCTCTCCAACATCTGCGACGGAATCCTCAAGCTCCTCGACACGCGCCTCGTCCCCTCCGCCGCCTCCGGCGACTCCAAGGTCTTCTACCTCAAGATGAAGGGAGACTACCACAGGTACCTCGCTGAGTTCAAGACCGGCGCCGACCGCAAGGAAGCCGCCGAGAGCACGCTCTCCGCCTACAAAGCCGCTCAGGACATTGCTAACACCGAGCTGCCTCCAACTCACCCTATCAGGCTGGGTCTTGCTCTGAATTTCTCTGTGTTTTACTATGAGATTCTTAACTCTCCTGATCGTGCATGCAGCCTTGCAAAACAGGCTTTTGATGAGGCTATTGCTGAATTGGATACGTTGGGAGAGGAATCATACAAGGATAGCACTTTGATCATGCAACTTCTTCGTGATAACCTTACCCTCTGGACCTCTGACATGCAGGATGATGGTGCAGATGAAATTAAAGAAGCCGCACCCAAAGGTGACGGGGAACAAAATTAA
Predicted protein sequences of Glyma02g37120
>Glyma02g37120.1   sequence type=predicted peptide   gene model=Glyma02g37120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAASAPTPREEFVYMAKLAEQAERYEEMVEFMEKVSASAESEELTVEERNLLSVAYKNVIGARRASWRIISSIEQKEESRGNEDHVAVIRDYRSKIEAELSNICDGILKLLDTRLVPSAASGDSKVFYLKMKGDYHRYLAEFKTGADRKEAAESTLSAYKAAQDIANTELPPTHPIRLGLALNFSVFYYEILNSPDRACSLAKQAFDEAIAELDTLGEESYKDSTLIMQLLRDNLTLWTSDMQDDGADEIKEAAPKGDGEQN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo