SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g37020

Feature Type:gene_model
Chromosome:Gm02
Start:42348789
stop:42350865
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g37020
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G30440AT Annotation by Michelle Graham. TAIR10: UDP-D-glucuronate 4-epimerase 1 | chr4:14881976-14883265 REVERSE LENGTH=429 SoyBaseE_val: 0ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0009225GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide-sugar metabolic process SoyBaseN/AISS
GO:0044237GO-bp Annotation by Michelle Graham. GO Biological Process: cellular metabolic process SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0016857GO-mf Annotation by Michelle Graham. GO Molecular Function: racemase and epimerase activity, acting on carbohydrates and derivatives SoyBaseN/AISS
GO:0050378GO-mf Annotation by Michelle Graham. GO Molecular Function: UDP-glucuronate 4-epimerase activity SoyBaseN/AISS
GO:0050662GO-mf Annotation by Michelle Graham. GO Molecular Function: coenzyme binding SoyBaseN/AISS
KOG1371 KOG UDP-glucose 4-epimerase/UDP-sulfoquinovose synthase JGI ISS
PTHR10366Panther NAD DEPENDENT EPIMERASE/DEHYDRATASE JGI ISS
PTHR10366:SF42Panther UDP-GLUCOSE 4-EPIMERASE JGI ISS
PF01370PFAM NAD dependent epimerase/dehydratase family JGI ISS
UniRef100_B9SQF3UniRef Annotation by Michelle Graham. Most informative UniRef hit: UDP-glucuronate 5-epimerase, putative n=1 Tax=Ricinus communis RepID=B9SQF3_RICCO SoyBaseE_val: 0ISS
UniRef100_I1JGU4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JGU4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma02g37020
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g37020
ParalogEvidenceComments
Glyma17g07740 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g37020 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g208000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g37020
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g37020
>Glyma02g37020.1   sequence type=CDS   gene model=Glyma02g37020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGTCCTTAGAGGAGGAGCTCTTCCCTTCAACCCCAGGCAAGTTCAAGATCGAGCGGGCCCACCACATGAACCGCCAGCTCTACCGCTGCTTCGCCTCCACCAGCACCATGTTCCTGTGGGCCCTCTTTTTAATCGCCCTCACCGCTTCATATCTCAGCTTCCAAGGCTTCGTTGATTCCGGCAGCCGCTACCTCTCCGCCTCCTGGGGCGGGATCCAGTGGGAGAAGCAGGTCCGCACCTCCGCCCAGATCCACCGTCAAGGCGGCATGTCCGTCCTCGTCACCGGCGCTGCCGGCTTCGTCGGCTCCCACGTCTCCCTCGCGTTAAAACGACGCGGAGACGGCGTCGTCGGACTCGACAACTTCAACGACTACTACGATCCGTCTCTGAAAAAAGCCCGCAAGTCCCTCCTCGCCAAGCATGACGTCTTCATCGTCGATGGCGACCTCAACGACGCCAAGCTCTTGGCAAAGCTCTTCGATGTGGTCGCTTTCACCCACGTGATGCACCTCGCGGCGCAGGCCGGGGTTCGCTACGCCATGGAGAATCCCCACTCCTACGTCCACAGCAACATCGCGGGCCTCGTCACGCTTCTCGAGGCCTGCAAATCGGCGAACCCTCAGCCCGCGGTCGTTTGGGCCTCGTCCAGCTCCGTCTACGGGCTCAACGAGAAGGTTCCATTTTCCGAATCGGACCAGACCGACCGGCCCGCTAGCCTCTACGCCGCAACCAAAAAAGCCGGTGAGGAAATCACACACACCTACAATCACATCTACGGCTTATCCATCACCGGTTTGAGGTTTTTCACCGTGTACGGACCCTGGGGGAGGCCCGACATGGCTTATTTCTCTTTCACCAGAAACATCTTACAAGGGAAACCTATCACCGTTTACCGCGGTAAAAACCATGTCGACCTGGCCAGGGATTTCACCTACATTGATGATATTGTCAAGGGTTGCGTCGGGTCGTTGGATACTTCGGCCAAGAGTACCGGGTCGGGTGGGAAGAAACGGGGACCCGCTCCGTATAGAATATTTAACCTGGGGAACACGTCGCCGGTTACTGTTCCCACTCTTGTCAGTATATTGGAGCGCCATTTGAAGGTGAAGGCCAAGAGGAATATTGTGGACATGCCTGGAAACGGCGACGTTCCGTTTACTCACGCGAATATTAGTTCGGCCCGGAGAGAACTCGGGTACAAGCCCACCACCGATTTGCAAACCGGGTTGAAGAAGTTCGTCAAGTGGTACCTTTCCTATTACGGCTACAATCACGGCAAACCTGTAAATTAA
Predicted protein sequences of Glyma02g37020
>Glyma02g37020.1   sequence type=predicted peptide   gene model=Glyma02g37020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPSLEEELFPSTPGKFKIERAHHMNRQLYRCFASTSTMFLWALFLIALTASYLSFQGFVDSGSRYLSASWGGIQWEKQVRTSAQIHRQGGMSVLVTGAAGFVGSHVSLALKRRGDGVVGLDNFNDYYDPSLKKARKSLLAKHDVFIVDGDLNDAKLLAKLFDVVAFTHVMHLAAQAGVRYAMENPHSYVHSNIAGLVTLLEACKSANPQPAVVWASSSSVYGLNEKVPFSESDQTDRPASLYAATKKAGEEITHTYNHIYGLSITGLRFFTVYGPWGRPDMAYFSFTRNILQGKPITVYRGKNHVDLARDFTYIDDIVKGCVGSLDTSAKSTGSGGKKRGPAPYRIFNLGNTSPVTVPTLVSILERHLKVKAKRNIVDMPGNGDVPFTHANISSARRELGYKPTTDLQTGLKKFVKWYLSYYGYNHGKPVN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo