|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G11840 | AT | Annotation by Michelle Graham. TAIR10: plant U-box 24 | chr3:3736578-3738250 REVERSE LENGTH=470 | SoyBase | E_val: 2.00E-40 | ISS |
| GO:0000165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: MAPK cascade | SoyBase | N/A | ISS |
| GO:0002679 | GO-bp | Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response | SoyBase | N/A | ISS |
| GO:0006499 | GO-bp | Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0006952 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response | SoyBase | N/A | ISS |
| GO:0009595 | GO-bp | Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus | SoyBase | N/A | ISS |
| GO:0009627 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance | SoyBase | N/A | ISS |
| GO:0009693 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process | SoyBase | N/A | ISS |
| GO:0009697 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010200 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to chitin | SoyBase | N/A | ISS |
| GO:0010310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0016567 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein ubiquitination | SoyBase | N/A | ISS |
| GO:0031348 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response | SoyBase | N/A | ISS |
| GO:0035556 | GO-bp | Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction | SoyBase | N/A | ISS |
| GO:0042742 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to bacterium | SoyBase | N/A | ISS |
| GO:0043069 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death | SoyBase | N/A | ISS |
| GO:0043900 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process | SoyBase | N/A | ISS |
| GO:0050832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to fungus | SoyBase | N/A | ISS |
| GO:0051865 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein autoubiquitination | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0004842 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity | SoyBase | N/A | ISS |
| UniRef100_B9SDI6 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Spotted leaf protein, putative n=1 Tax=Ricinus communis RepID=B9SDI6_RICCO | SoyBase | E_val: 2.00E-55 | ISS |
| UniRef100_UPI00023370FF | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI00023370FF related cluster n=1 Tax=unknown RepID=UPI00023370FF | SoyBase | E_val: 2.00E-95 | ISS |
|
Glyma02g35436 not represented in the dataset |
Glyma02g35436 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.02g196200 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma02g35436.1 sequence type=CDS gene model=Glyma02g35436 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGTGGAAGCTGGTTTGGTTCACGAACTCATTGAGATCGAACTAATGGAACCAGAAAAAAGAATCACGGAACTAACCCTAGCAATATTGTTTCATTTGTGCTCTTGCGCCAACGGAAGAGCCAAGTTTCTGAGCCACGAAGGGTCCATCGCGGTGGTGACGGAGAGAATACTGAAGGTTTCGGCATCGGTGGACGATAGGGCCGTGTTTGTTCTCTCACAGGTTTCGAAGTTTTCGGGCACGACCATGGTCTTGCAGGAGATGTTGAGAGTGGGGACTGTGGCGAAGCTTTGCATGGTGCTTCAGGCTGATCGTGCCAAGTATTTGAAGGACAAAGCGATGGAGATTCTCAAGGGGCACTCTGAGGTTTGGGCGAACTCTCCTTGCATTCCCAATACGTCTTTTGGTGGATACGTGAAATACTGA
>Glyma02g35436.1 sequence type=predicted peptide gene model=Glyma02g35436 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MVEAGLVHELIEIELMEPEKRITELTLAILFHLCSCANGRAKFLSHEGSIAVVTERILKVSASVDDRAVFVLSQVSKFSGTTMVLQEMLRVGTVAKLCMVLQADRAKYLKDKAMEILKGHSEVWANSPCIPNTSFGGYVKY*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||