SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g35350): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g35350): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g35350

Feature Type:gene_model
Chromosome:Gm02
Start:40092254
stop:40093510
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G35930AT Annotation by Michelle Graham. TAIR10: plant U-box 23 | chr2:15083101-15084336 REVERSE LENGTH=411 SoyBaseE_val: 8.00E-160ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051865GO-bp Annotation by Michelle Graham. GO Biological Process: protein autoubiquitination SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
PTHR22849Panther WDSAM1 PROTEIN JGI ISS
PF04564PFAM U-box domain JGI ISS
PF05804PFAM Kinesin-associated protein (KAP) JGI ISS
UniRef100_B9SDI7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Spotted leaf protein, putative n=1 Tax=Ricinus communis RepID=B9SDI7_RICCO SoyBaseE_val: 2.00E-170ISS
UniRef100_I1JGH3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JGH3_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g35350 not represented in the dataset

Glyma02g35350 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g10110 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g195900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g35350.1   sequence type=CDS   gene model=Glyma02g35350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACGAGATCGACGTGCCTCCGTTCTTCGTGTGCCCTATTTCATTAGAGCTCATGAAGGACCCCGTGACGGTCTCCACCGGCATCACCTACGACCGCGACAGCATCGAGAAGTGGCTCTTCGCCGAGGTGAAGAACGACACGTGTCCCGTCACGAAGCAGCCCCTCCTCCCGGACCTCACTCCGAACCACACGCTCCGCAGACTCATCCAAGCCTGGTGCACCGTCAACGCCTCCCACGGCGTCCAGAGAATCCCCACACCAAAACCACCGGTCGACAAAACCCTCATCGAGAAACTCCTCCGCAACACCTCGGCTTCGGACTCCCCGAGCCTCCAGCTCCGGTCCCTCCGAACCCTCAAGTCCATTGCCTCGGAATCCCAATCAAACAAACGCTGCATCGAATCTGCAGAAGGCGCAGTTAATTTCCTAGCAACAATTATAACCACCACCACCACCACCACCACCAACCTACTCGATGATGACATCGAGTTGGAAATAAAAACAAGTACAGCCCACGAAGCATTGAGCCTTTTACACAGCATTCAGCTGTCAGAGTCCGGTTTGAAGGCTCTGTTGAACCATCCAGAATTTATAAACTCTCTAACCAAGATGATGCAAAGAGGGATCTACGAGTCACGCGCCTACGCTGTTTTCTTGCTGAATTCCTTGTCCGAGGTGGCGGATCCGGCGCAGTTGATTAACCTAAAAACTGATTTGTTCACTGAATTGGTTCAGGTTCTTAAGGATCAGGTTTCGGAGAAGGTCTCGAAGGCGACCCTGCAGGCATTGATTCAGGTGTGTTCGTGGGGCAGAAATAGGGTGAAGGCTGTGGAGGCTGGAGCTGTGCCGGTTCTGGTGGAGCTTCTTCTCGAATGCAACGAGAGAAAACCGATAGAAATGGTGCTGGTTTTGTTGGAGATTTTATGTCAGAGTGCTGACGGGAGGGCGGGGCTGTTGGCCCACGCGGCGGGGGTGGTGATCGTGGCGAAGAAGATTCTGAGGGTTTCAACGATGGCGAACGATAGGGCGGCGAAGATTCTGCTTTCGGTGTGCAGATTTTCCCCCACGCCGGGCTTGGTGCAGGAGATGGTGCAGCTTGGGGTGGTGGCAAAGCTTTGTCTGGTGCTGCAGGTGGATAGTGGGAACAAAGCAAAAGAGAAAGCTAGGGAGATTCTCAAATTGCATGCTAGGGCTTGGAGGAATTCGCCTTGCATACCTCACAATTTGCTTGCTTCGTTTCCAATGAGTTCGTGA

>Glyma02g35350.1   sequence type=predicted peptide   gene model=Glyma02g35350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDEIDVPPFFVCPISLELMKDPVTVSTGITYDRDSIEKWLFAEVKNDTCPVTKQPLLPDLTPNHTLRRLIQAWCTVNASHGVQRIPTPKPPVDKTLIEKLLRNTSASDSPSLQLRSLRTLKSIASESQSNKRCIESAEGAVNFLATIITTTTTTTTNLLDDDIELEIKTSTAHEALSLLHSIQLSESGLKALLNHPEFINSLTKMMQRGIYESRAYAVFLLNSLSEVADPAQLINLKTDLFTELVQVLKDQVSEKVSKATLQALIQVCSWGRNRVKAVEAGAVPVLVELLLECNERKPIEMVLVLLEILCQSADGRAGLLAHAAGVVIVAKKILRVSTMANDRAAKILLSVCRFSPTPGLVQEMVQLGVVAKLCLVLQVDSGNKAKEKAREILKLHARAWRNSPCIPHNLLASFPMSS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo