SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g35210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g35210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g35210

Feature Type:gene_model
Chromosome:Gm02
Start:39946153
stop:39949015
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g35210
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11820AT Annotation by Michelle Graham. TAIR10: syntaxin of plants 121 | chr3:3729540-3730868 REVERSE LENGTH=346 SoyBaseE_val: 4.00E-136ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0006862GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide transport SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009625GO-bp Annotation by Michelle Graham. GO Biological Process: response to insect SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009963GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process SoyBaseN/AISS
GO:0010119GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement SoyBaseN/AISS
GO:0010148GO-bp Annotation by Michelle Graham. GO Biological Process: transpiration SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015696GO-bp Annotation by Michelle Graham. GO Biological Process: ammonium transport SoyBaseN/AISS
GO:0015802GO-bp Annotation by Michelle Graham. GO Biological Process: basic amino acid transport SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0043269GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of ion transport SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0045087GO-bp Annotation by Michelle Graham. GO Biological Process: innate immune response SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051245GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of cellular defense response SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0072660GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of protein location in plasma membrane SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009504GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell plate SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0031201GO-cc Annotation by Michelle Graham. GO Cellular Compartment: SNARE complex SoyBaseN/AISS
GO:0005484GO-mf Annotation by Michelle Graham. GO Molecular Function: SNAP receptor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0043495GO-mf Annotation by Michelle Graham. GO Molecular Function: protein anchor SoyBaseN/AISS
KOG0810 KOG SNARE protein Syntaxin 1 and related proteins JGI ISS
PTHR19957Panther SYNTAXIN JGI ISS
PTHR19957:SF26Panther SYNTAXIN, ARABIDOPSIS THALIANA JGI ISS
PF00804PFAM Syntaxin JGI ISS
PF05739PFAM SNARE domain JGI ISS
UniRef100_B7FI20UniRef Annotation by Michelle Graham. Most informative UniRef hit: Syntaxin-121 n=2 Tax=Medicago truncatula RepID=B7FI20_MEDTR SoyBaseE_val: 2.00E-172ISS
UniRef100_I1JGG8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JGG8_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma02g35210
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g35210 not represented in the dataset
Glyma02g35210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g35210
ParalogEvidenceComments
Glyma10g10210 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g35210 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g195300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g35210
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g35210
>Glyma02g35210.1   sequence type=CDS   gene model=Glyma02g35210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACGACTTGTTCTCCGGCTCCTTCTCCCGCACCAATGACCAAGTCTCGCCGGACCACCACCATGTGATCGAGATGGCGGCCACCGCATCGCCAACGGCCGAGGGAAGCGTGAATCTCGAAAAGTTCTTTCAAGAAGTTGAGCAGGTAAAAGAGGAGCTGAAGGAGCTAGAGCGTCTCCATGAAAATCTGCGTGGGTCCCACGAGAAAAGCAAGATCCTTCACAGCGCCAAAGCTGTGAAGGAACTTCGCTTACGCATGGACAGTGACGTGACACTTGCTCTAAAGAATGCAAAGCTCGTTAAGGTTCGGCTTGAGGCACTGGACCGGTCCAACCAGACCAGTCAAAGCTTGCCTGGTTCGGGACCTGGTTCGTCCTCAGACCGGACCAGAACGTCCGTTGTGAGCGGACTGAGGAAGAAGCTGAAGGACTCGATGGACAGCTTCAACAGCCTCAGACAAAAGATATCGTCAGAGTATAGGGAAACCGTGCAGCGTAGATATTATACTGTCACCGGAGAGAACCCTGATGACAAAACCATTGATCTCCTTATTTCTACGGGTGAGAGTGAAACATTCTTGCAGAAGGCGATCCAGCAGCAAGGTAGAGCCAGTGTGATGGACACGATCCAAGAGATTCAAGAGAGGCACGACACAGTCAAGGAAATAGAGAGAAACCTAAACGAGCTCCACCAAGTGTTCTTGGACATGGCCGTGCTGGTGCAGTCCCAGGGCGAACAACTGGACGACATCGAGAGCCACGTGGCGCGCGCCAATTCGTACGTGCGGGGTGGGGTCCAGCAGTTGCACGTGGCAAGGAAGCACCAGAAGAACACCCGAAAGTGGACATGCATAGCCATCATACTGCTCATTATTATCATCTTGATTATAGTCCTCCCTATAGTTCTAAGAAATTGA
Predicted protein sequences of Glyma02g35210
>Glyma02g35210.1   sequence type=predicted peptide   gene model=Glyma02g35210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNDLFSGSFSRTNDQVSPDHHHVIEMAATASPTAEGSVNLEKFFQEVEQVKEELKELERLHENLRGSHEKSKILHSAKAVKELRLRMDSDVTLALKNAKLVKVRLEALDRSNQTSQSLPGSGPGSSSDRTRTSVVSGLRKKLKDSMDSFNSLRQKISSEYRETVQRRYYTVTGENPDDKTIDLLISTGESETFLQKAIQQQGRASVMDTIQEIQERHDTVKEIERNLNELHQVFLDMAVLVQSQGEQLDDIESHVARANSYVRGGVQQLHVARKHQKNTRKWTCIAIILLIIIILIIVLPIVLRN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo