Glyma02g35090 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g35090

Feature Type:	gene_model
Chromosome:	Gm02
Start:	39851697
stop:	39852949
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g35090

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G35910	AT	Annotation by Michelle Graham. TAIR10: RING/U-box superfamily protein \| chr2:15073225-15073878 REVERSE LENGTH=217	SoyBase	E_val: 6.00E-54	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
KOG1493	KOG	Anaphase-promoting complex (APC), subunit 11	JGI		ISS
PTHR14155	Panther	RING FINGER PROTEIN 6/12/38	JGI		ISS
PF00097	PFAM	Zinc finger, C3HC4 type (RING finger)	JGI		ISS
UniRef100_G7I8H8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: RING finger-like protein n=1 Tax=Medicago truncatula RepID=G7I8H8_MEDTR	SoyBase	E_val: 4.00E-70	ISS
UniRef100_I1JGG4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1JGG4_SOYBN	SoyBase	E_val: 1.00E-118	ISS

Expression Patterns of Glyma02g35090

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g35090

Paralog	Evidence	Comments
Glyma10g10280	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g35090 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g194400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g35090

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g35090

Limit To All Plant Sequences

>Glyma02g35090.1   sequence type=CDS   gene model=Glyma02g35090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACAACACAACCGATTCCGGATTCCTCGGGTCCAACAACATAAGTGGCTTTGGCATGGGGATAGGAATCTCAATTGGGATTCTTCTGCTCATCACAACCATCACACTCACCTCCTACTTCTGCACCAGGGCACAAGTGCCAACTCCTCCAAGGAGAAGAGGAACAAGTAATTCCAATCCACAATTCCTTGAGCCACACCACACAATAGTTGATGTTGGCCTTGATGAAGCCACAATCATGAACTACCCCAAAATGCTCTACTCTGAAGCCAAGCTAAGGAAATCTGATTCCACTTCAACAAGCTGCTCCATATGTCTTGGAGATTACAAAGGTTCTGATTTGCTAAGGGTGTTGCCTGATTGTGACCATGTCTTTCACCTCAAGTGCATAGACCCTTGGCTGAGGCTGCATCCAACTTGTCCTCTCTGCAGAACATCACCAATTCCGACACCTCTCTCAACTCCTCTGGCCGAAGTGATCCCTTTAGCAACCAGGCGAGATTAA

Predicted protein sequences of Glyma02g35090

Limit To All Plant Sequences

>Glyma02g35090.1   sequence type=predicted peptide   gene model=Glyma02g35090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNNTTDSGFLGSNNISGFGMGIGISIGILLLITTITLTSYFCTRAQVPTPPRRRGTSNSNPQFLEPHHTIVDVGLDEATIMNYPKMLYSEAKLRKSDSTSTSCSICLGDYKGSDLLRVLPDCDHVFHLKCIDPWLRLHPTCPLCRTSPIPTPLSTPLAEVIPLATRRD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain