SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g35064

Feature Type:gene_model
Chromosome:Gm02
Start:39829294
stop:39830275
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g35064
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G64860AT Annotation by Michelle Graham. TAIR10: sigma factor A | chr1:24098497-24100746 FORWARD LENGTH=502 SoyBaseE_val: 6.00E-38ISS
GO:0006352GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, initiation SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0071461GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to redox state SoyBaseN/AISS
GO:0071482GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to light stimulus SoyBaseN/AISS
GO:0080005GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem stoichiometry adjustment SoyBaseN/AISS
GO:2001141GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of RNA biosynthetic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0003899GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA-directed RNA polymerase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016987GO-mf Annotation by Michelle Graham. GO Molecular Function: sigma factor activity SoyBaseN/AISS
UniRef100_B9SDF8UniRef Annotation by Michelle Graham. Most informative UniRef hit: RNA polymerase sigma factor rpoD, putative n=1 Tax=Ricinus communis RepID=B9SDF8_RICCO SoyBaseE_val: 6.00E-48ISS
UniRef100_I1LP24UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LP24_SOYBN SoyBaseE_val: 1.00E-92ISS

Expression Patterns of Glyma02g35064
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g35064 not represented in the dataset
Glyma02g35064 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g35064 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma02g35064
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g35064
>Glyma02g35064.1   sequence type=CDS   gene model=Glyma02g35064   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACTGCTGTAGTAATTGGACTCAGTGGAGGAAAGAGGCTCTTGAGTTCATCATACCATTACTCTGATATTATAGAAAAGCTTTCTTATGGCAGTGATTTTGGATCCACACACTACCAAATTGTTCCTAAAAAATCTTTAATAGTTGCCAAGAAGTCATCCAACTATACTCCAACTTTTCCAGCATCGAACCAACAGAATCAGTTCATTAAGGCTCTTAAGGAGCATGTTGATGATGCCCCTACCATTGTGGATCCATGGTTTCAGAGTTACAACTCTAATGACTTAGAGGTAGAAAGCTCTGAAATGGGTTATTCTCTGGAGGCTCTTCTTTTGCTGCAGAAGTCAATGCTGGAAAAGCAATGGAACCTTTCCTTTGAAAAGGAAATGCTTACTGAAAATTTGAGTAAGGGAAAAAAATGTAGGAAAGTGACCCTCTAG
Predicted protein sequences of Glyma02g35064
>Glyma02g35064.1   sequence type=predicted peptide   gene model=Glyma02g35064   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATAVVIGLSGGKRLLSSSYHYSDIIEKLSYGSDFGSTHYQIVPKKSLIVAKKSSNYTPTFPASNQQNQFIKALKEHVDDAPTIVDPWFQSYNSNDLEVESSEMGYSLEALLLLQKSMLEKQWNLSFEKEMLTENLSKGKKCRKVTL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo