Glyma02g34640 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g34640

Feature Type:	gene_model
Chromosome:	Gm02
Start:	39001908
stop:	39006708
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g34640

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G41490	AT	Annotation by Michelle Graham. TAIR10: UDP-glcnac-adolichol phosphate glcnac-1-p-transferase \| chr2:17301762-17304030 FORWARD LENGTH=431	SoyBase	E_val: 0	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0003975	GO-mf	Annotation by Michelle Graham. GO Molecular Function: UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity	SoyBase	N/A	ISS
GO:0008963	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phospho-N-acetylmuramoyl-pentapeptide-transferase activity	SoyBase	N/A	ISS
KOG2788	KOG	Glycosyltransferase	JGI		ISS
PTHR10571	Panther	GLUCOSAMINEPHOSPHOTRANSFERASE	JGI		ISS
PF00953	PFAM	Glycosyl transferase family 4	JGI		ISS
UniRef100_C6TK31	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TK31_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_G1FCL5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: UDP-GlcNac-dolichyl-phosphate N-acetylglucosaminephosphotransferase n=1 Tax=Solanum tuberosum RepID=G1FCL5_SOLTU	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma02g34640

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g34640

Paralog	Evidence	Comments
Glyma10g16320	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g34640 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g190700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g34640

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g34640

Limit To All Plant Sequences

>Glyma02g34640.1   sequence type=CDS   gene model=Glyma02g34640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGCACGAAAGAGACTCTCTTCTTCCGAACCTCCTTCTTCTTCTCCTCCCGCAACAAATGAAAACACAAACACAACTGCCAAACCCACCATAACAGACCCTCCAATCGCGCCTCCCAAATGGGGTCTTCTTCTGAAGCTCTCTCTCTTTTTGCTCCCTTACTTGTACCTCCTCTTTCACCACTACCCCATCGAGCCGGAGCTCCGAAGTTCGATCCTCATCAACGCCGGAATGAGCCTCGCGGGGCTCTTCGTCACGGTCAAGATGATCCCCGTCGCGTCCCGCTACGTCCAGAAGCGGAACCTCTTTGGGTATGACATCAACAAGAAGGGCACCCCTCAGGGAACCGTCAAAGTGCCTGAGTCATTAGGTATAGTTGTTGGTATTGTCTTCTTGGTTGTGGCAATCTTGTTTCAGTATTTTAACTTCACAGCAGATTCGAATTGGCTTGTTGAATACAATGCAGCGCTAGCGTGCATCTGTTTCATGACATTGCTAGGATTTGTTGACGATGTCCTTGATGTCCCATGGAGAGTAAAATTACTACTCCCATCAATTGCTGCACTTCCTTTGTTAATGGCATATGCTGGACACACAACTATAGTTATACCAAAGCCACTTGTCCCACACATTGGGATTGAGGTTTTGGATCTTGGATGGATGTATAAACTATATATGGGGCTATTGGCTGTTTTTTGCACAAATTCCATCAATATACATGCTGGAATAAATGGCCTTGAAGTTGGGCAGACTGTGGTTATCGCATCAGCTATCCTGATACACAATATTATGCAAATTGGAGCATCAACAGATCCTGAATATAAGCTAGCACATGCATTTTCTATTTACTTAGCTCAGCCCTTGCTAGCTACCTCTTTGGCTTTACTTTCTTACAACTGGTATCCCTCTTCAGTTTTTGTTGGTGATACATATACATACTTTGCTGGGATGACTATGGCTGTGATTGGTATTTTAGGCCATTTTAGTGAAACACTCTTGATTTTCTTCTTACCTCAAGTTTTGAACTTCCTCTTGTCACTCCCCCAGCTTTCTGGCTATATTCCTTGTCCACGTCATCGACTGCCAAGGTTTGACCCTCAAACTGGACTACTGACTGGGACAAATGATGGGACACTTGTTAACTTCTTTCTAAGAAATTTAGGCCGAAAGTCCGAAAAGGCACTTTGTATTTATCTTCTTGCTTTCCAGGCTATAGCGTGCTGTTTATGTTTCTTGCTACGGTATTTCCTTGCTGGTTGGTACAAATGA

Predicted protein sequences of Glyma02g34640

Limit To All Plant Sequences

>Glyma02g34640.1   sequence type=predicted peptide   gene model=Glyma02g34640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGARKRLSSSEPPSSSPPATNENTNTTAKPTITDPPIAPPKWGLLLKLSLFLLPYLYLLFHHYPIEPELRSSILINAGMSLAGLFVTVKMIPVASRYVQKRNLFGYDINKKGTPQGTVKVPESLGIVVGIVFLVVAILFQYFNFTADSNWLVEYNAALACICFMTLLGFVDDVLDVPWRVKLLLPSIAALPLLMAYAGHTTIVIPKPLVPHIGIEVLDLGWMYKLYMGLLAVFCTNSINIHAGINGLEVGQTVVIASAILIHNIMQIGASTDPEYKLAHAFSIYLAQPLLATSLALLSYNWYPSSVFVGDTYTYFAGMTMAVIGILGHFSETLLIFFLPQVLNFLLSLPQLSGYIPCPRHRLPRFDPQTGLLTGTNDGTLVNFFLRNLGRKSEKALCIYLLAFQAIACCLCFLLRYFLAGWYK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain