Glyma02g30940 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g30940

Feature Type:	gene_model
Chromosome:	Gm02
Start:	33454218
stop:	33455543
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g30940

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G27750	AT	Annotation by Michelle Graham. TAIR10: binding \| chr4:13841708-13843501 FORWARD LENGTH=305	SoyBase	E_val: 1.00E-45	ISS
GO:0006109	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0009745	GO-bp	Annotation by Michelle Graham. GO Biological Process: sucrose mediated signaling	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
PF08045	PFAM	Cell division control protein 14, SIN component	JGI		ISS
UniRef100_I1LJ32	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LJ32_SOYBN	SoyBase	E_val: 7.00E-56	ISS
UniRef100_Q5TJC4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Impaired sucrose induction 1-like protein n=1 Tax=Medicago truncatula RepID=Q5TJC4_MEDTR	SoyBase	E_val: 1.00E-47	ISS

Expression Patterns of Glyma02g30940

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g30940 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.02g179000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma02g30940

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g30940

Limit To All Plant Sequences

>Glyma02g30940.1   sequence type=CDS   gene model=Glyma02g30940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTTGTAAGGTTCGATTGGAATCTGAGTCATGTATTATTTAGTGTTGAACCGATGAAGTTGACGAGTCCATCCACTGATGCTGAAGTTGAGCTCGCTCTTAGAGTCTTGGAAGGGTGTTGTTTGATTCACCCTCAAAGTACTGCTCTCGCCCATCAACACAACGCTATTCAAGTTTTAATGAATATATTATCCACTCGTGGAGTGCTTGAGCAAGGTGCATGCTTAGATGCTCTAATCTCATTGGTGATGGATTCATCATCCAATCAAATGGATTTTGAGAAATGTAGTGGTATTATGGAAGTTGCTGACACAAGGCAAATCAGTGTTGTTGCCAATGAAATATGCCAAAGGCTCCCTTCAAAGAAGTTTCCACTTATCATTTTGCATAATAAACGGATTAAGGGAGACAAAATGGATGAACCAATCAATAGAGCATTAATTGATAAGTGGAATAATGCTGATGCACTCTATGCAACACCTACTGGATCAAATGATGATTGTCTTTGGTTAAATCATGTAATATGTTTGGCTTTGTTTCTCTTTCTTTGA

Predicted protein sequences of Glyma02g30940

Limit To All Plant Sequences

>Glyma02g30940.1   sequence type=predicted peptide   gene model=Glyma02g30940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
FVRFDWNLSHVLFSVEPMKLTSPSTDAEVELALRVLEGCCLIHPQSTALAHQHNAIQVLMNILSTRGVLEQGACLDALISLVMDSSSNQMDFEKCSGIMEVADTRQISVVANEICQRLPSKKFPLIILHNKRIKGDKMDEPINRALIDKWNNADALYATPTGSNDDCLWLNHVICLALFLFL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain