SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G44070 | AT | Annotation by Michelle Graham. TAIR10: phytochelatin synthase 1 (PCS1) | chr5:17734876-17737672 FORWARD LENGTH=485 | SoyBase | E_val: 3.00E-42 | ISS |
| GO:0000165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: MAPK cascade | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0009409 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cold | SoyBase | N/A | ISS |
| GO:0009595 | GO-bp | Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus | SoyBase | N/A | ISS |
| GO:0009697 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009814 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction | SoyBase | N/A | ISS |
| GO:0009862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010038 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to metal ion | SoyBase | N/A | ISS |
| GO:0010200 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to chitin | SoyBase | N/A | ISS |
| GO:0010310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0015700 | GO-bp | Annotation by Michelle Graham. GO Biological Process: arsenite transport | SoyBase | N/A | ISS |
| GO:0019684 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction | SoyBase | N/A | ISS |
| GO:0031348 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response | SoyBase | N/A | ISS |
| GO:0042344 | GO-bp | Annotation by Michelle Graham. GO Biological Process: indole glucosinolate catabolic process | SoyBase | N/A | ISS |
| GO:0042742 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to bacterium | SoyBase | N/A | ISS |
| GO:0043900 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process | SoyBase | N/A | ISS |
| GO:0046685 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to arsenic-containing substance | SoyBase | N/A | ISS |
| GO:0046686 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cadmium ion | SoyBase | N/A | ISS |
| GO:0046938 | GO-bp | Annotation by Michelle Graham. GO Biological Process: phytochelatin biosynthetic process | SoyBase | N/A | ISS |
| GO:0050832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to fungus | SoyBase | N/A | ISS |
| GO:0052544 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response by callose deposition in cell wall | SoyBase | N/A | ISS |
| GO:0005829 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosol | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0005507 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: copper ion binding | SoyBase | N/A | ISS |
| GO:0015446 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: arsenite-transmembrane transporting ATPase activity | SoyBase | N/A | ISS |
| GO:0016756 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: glutathione gamma-glutamylcysteinyltransferase activity | SoyBase | N/A | ISS |
| GO:0046870 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: cadmium ion binding | SoyBase | N/A | ISS |
| GO:0046872 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: metal ion binding | SoyBase | N/A | ISS |
| PF09328 | PFAM | Domain of unknown function (DUF1984) | JGI | ISS | |
| UniRef100_Q2QKL5 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Glutathione gamma-glutamylcysteinyltransferase 3 n=1 Tax=Lotus japonicus RepID=PCS3_LOTJA | SoyBase | E_val: 1.00E-118 | ISS |
| UniRef100_UPI0002336CCE | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI0002336CCE related cluster n=1 Tax=unknown RepID=UPI0002336CCE | SoyBase | E_val: 7.00E-178 | ISS |
|
Glyma02g30024 not represented in the dataset |
Glyma02g30024 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.02g176300 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma02g30024.1 sequence type=CDS gene model=Glyma02g30024 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTGTTGTAGACATGAAGGTTGGAGCAGTGTTGCCAAATTTCTAACCAAAGATGTCCCTCAACTTCTAAAGTCAGAGGATCTAAAAGACATTCAGGAAGTACTCTCTCTTGCTTTTAAATCTCCTCCCAGTGAATTGAGAGGGTTAATAACATGGATTGTTGAAGTTCGCAGACAAGAAGATGGGAATCTCACATTGAGTGAGGAGGAGAAAGGAAGGCTAGTTATCAAGGCTCACATACTGGAACAGATTCAAACAACTGGACTCTTCAAACACGTGACAAGGTGGTTGGATTCTAAAAGTTCATGTTGTAATACTTTGGCAAACCTTGGTGACAAAGATATGTTACCAGCACTTGCTGCCAGTGTTTGTTGCCAAGCAGCAAATCTTTTGACTGTTTGTGGTAGGCTAGGTTTGTTAGGTGGAAAATGCTGTAGTCAAATAGATGTAAAACATCTGAATGCTGATAGTGAAAATCCAGTAACATTAGTTTCAGGAACTGTTACAACTGGTGGTGGTAGTGAACAAGGAGTTGATGTGTTGGTCCCTTTGTGTCAAAGGGAACCAAGTAGGTTGTGTCTTTCTAATGAAGGTCACTGCATTGGCATGCACCCGTCTACTGCAGATGTCTTAACGGTGCTTTTATTGGCCTTGCCCTTGCATACGTGGTCTGGCATTAAAGAAGAAAAGTTGTGTGTGGAAGCTTTGAGCCTTCTAGCAACAGAAGATCTCCCTCCCCTACTTCAGGAAGAGGTAATGTCCATTTTTTAG
>Glyma02g30024.1 sequence type=predicted peptide gene model=Glyma02g30024 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MCCRHEGWSSVAKFLTKDVPQLLKSEDLKDIQEVLSLAFKSPPSELRGLITWIVEVRRQEDGNLTLSEEEKGRLVIKAHILEQIQTTGLFKHVTRWLDSKSSCCNTLANLGDKDMLPALAASVCCQAANLLTVCGRLGLLGGKCCSQIDVKHLNADSENPVTLVSGTVTTGGGSEQGVDVLVPLCQREPSRLCLSNEGHCIGMHPSTADVLTVLLLALPLHTWSGIKEEKLCVEALSLLATEDLPPLLQEEVMSIF*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
