SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g29900

Feature Type:gene_model
Chromosome:Gm02
Start:31884581
stop:31887264
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g29900
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G12160AT Annotation by Michelle Graham. TAIR10: RAB GTPase homolog A4D | chr3:3879495-3880437 REVERSE LENGTH=222 SoyBaseE_val: 5.00E-139ISS
GO:0007264GO-bp Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction SoyBaseN/AISS
GO:0009827GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification SoyBaseN/AISS
GO:0009860GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube growth SoyBaseN/AISS
GO:0015031GO-bp Annotation by Michelle Graham. GO Biological Process: protein transport SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0048610GO-bp Annotation by Michelle Graham. GO Biological Process: cellular process involved in reproduction SoyBaseN/AISS
GO:0048868GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube development SoyBaseN/AISS
GO:0080092GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of pollen tube growth SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0045177GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apical part of cell SoyBaseN/AISS
GO:0070382GO-cc Annotation by Michelle Graham. GO Cellular Compartment: exocytic vesicle SoyBaseN/AISS
GO:0090404GO-cc Annotation by Michelle Graham. GO Cellular Compartment: pollen tube tip SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
GO:0019900GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase binding SoyBaseN/AISS
KOG0087 KOG GTPase Rab11/YPT3, small G protein superfamily JGI ISS
PTHR24073Panther FAMILY NOT NAMED JGI ISS
PTHR24073:SF213Panther SUBFAMILY NOT NAMED JGI ISS
PF00071PFAM Ras family JGI ISS
UniRef100_D7MKD0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Small molecular weight G-protein 1 n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MKD0_ARALL SoyBaseE_val: 1.00E-120ISS
UniRef100_I1JG34UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JG34_SOYBN SoyBaseE_val: 4.00E-163ISS

Expression Patterns of Glyma02g29900
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g29900 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g176000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g29900
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g29900
>Glyma02g29900.1   sequence type=CDS   gene model=Glyma02g29900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGTCGAACCTGTACGGCGAATACAACCACAAGATCGACTACGTGTTCAAGGTGGTGCTGGTCGGAGACTCCGCCGTGGGGAAGACCCAGCTCCTCGCGCGCTTCGCCAAGAACCAATTCAACGTCGATTCTAAAGCCACCATTGGCGTCGAGTTTCAGACCAAAACGCTCATCATCGACAAGAAGACCGTCAAGGCCCAAATATGGGACACCGCCGGCCAAGAAAGGTACAGGGCAGTTACTAGTGCATATTATCGTGGTGCTGTTGGAGCAATGTTAGTTTATGACGTGACTAGACGCCCATCATTTGATAACATGGCAAAGTGGTTAGAGGAACTGCGGGGCCACGCTGACAAAAACATTGTTGTAATGCTAATTGGCAACAAGTGTGATCTTGGAACTCTTAGAGCGGTGCCAACTGAAGATGCCGAGGAGTTTGCGCAAAGAGAGAACCTATTCTTTATGGAGACATCAGCACTCGAGTCCACTAATGTGGAAACTGCCTTTCTGACCATTCTAACTGAGATATACAGACTTGTAAGCAAGAAAACACTGACTGCCAATGATGATGCAGATCCAAGTGGTATTTCAGGACTTCTGAAGGGAACCAAGATAATTGTTCCTAGCCAAGACATTAATGCTGGTGAAAAGAAGGGTGGCTGCTGTTGA
Predicted protein sequences of Glyma02g29900
>Glyma02g29900.1   sequence type=predicted peptide   gene model=Glyma02g29900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMSNLYGEYNHKIDYVFKVVLVGDSAVGKTQLLARFAKNQFNVDSKATIGVEFQTKTLIIDKKTVKAQIWDTAGQERYRAVTSAYYRGAVGAMLVYDVTRRPSFDNMAKWLEELRGHADKNIVVMLIGNKCDLGTLRAVPTEDAEEFAQRENLFFMETSALESTNVETAFLTILTEIYRLVSKKTLTANDDADPSGISGLLKGTKIIVPSQDINAGEKKGGCC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo