Glyma02g29281 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g29281

Feature Type:	gene_model
Chromosome:	Gm02
Start:	30796737
stop:	30797835
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma02g29281

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G42140	AT	Annotation by Michelle Graham. TAIR10: VQ motif-containing protein \| chr2:17568964-17569482 REVERSE LENGTH=172	SoyBase	E_val: 4.00E-29	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PF05678	PFAM	VQ motif	JGI		ISS
UniRef100_D7LVY8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: VQ motif-containing protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7LVY8_ARALL	SoyBase	E_val: 1.00E-25	ISS
UniRef100_UPI0002337143	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002337143 related cluster n=1 Tax=unknown RepID=UPI0002337143	SoyBase	E_val: 2.00E-139	ISS

Proteins Associated with Glyma02g29281

Locus	Gene Symbol	Protein Name
	VQ4	VQ motif containing protein gene 4

Expression Patterns of Glyma02g29281

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g29281 not represented in the dataset	Glyma02g29281 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g29281

Paralog	Evidence	Comments
Glyma09g17151	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g29281 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma02g29281

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma02g29281

Limit To All Plant Sequences

>Glyma02g29281.1   sequence type=CDS   gene model=Glyma02g29281   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAACATGAGGCTCATGAGGAAACACAATACTACTCACACATGCATGGCCAATAATTCACACACACCTTCTTCTTCCCTAGCCATGCACAAAGATTCCCACATGATATCCAAAACCAAACCAAAGATCCGCATAATCCACATATTTGCACCCGAGATCATAAAAACCGATGTGGAGAACTTCAGAGAGCTTGTGCAGAAGCTAACTGGGAGACCAAGTGGAGAAAATTTGAAGTGTTGCAACAAGAAGAAGGAAACAAGGGTTGTTGTGGCAAAACAAAGAGAGGAATTAGAATCTTATTCAAGTGAGAGTGGCATGTCAGAGGATCATCACAAAAACACAGTGAAAAATAATAATGGTGGGTGTTGTTGGGGGTTGGATGTGACAACAAGGGGCAAAGTCAAAGAAGAGGTTGTTGGGGTTTGTAATTGCAGTGATGAAAGTAATTCTTCTGGTGGGTACTTGGGGGGGTTCTCTGATTTGGAAGGGTTCATTTCTGATTTTGGTGGGTTTCCTTTGCTTCCTTTGGATGGGAATCACATCATGGAAGGGTTTGAAGAATCTCAACTTTTATAG

Predicted protein sequences of Glyma02g29281

Limit To All Plant Sequences

>Glyma02g29281.1   sequence type=predicted peptide   gene model=Glyma02g29281   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENMRLMRKHNTTHTCMANNSHTPSSSLAMHKDSHMISKTKPKIRIIHIFAPEIIKTDVENFRELVQKLTGRPSGENLKCCNKKKETRVVVAKQREELESYSSESGMSEDHHKNTVKNNNGGCCWGLDVTTRGKVKEEVVGVCNCSDESNSSGGYLGGFSDLEGFISDFGGFPLLPLDGNHIMEGFEESQLL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain