SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g29100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g29100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g29100

Feature Type:gene_model
Chromosome:Gm02
Start:30494342
stop:30497235
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G23630AT Annotation by Michelle Graham. TAIR10: phosphate deficiency response 2 | chr5:7960756-7967644 REVERSE LENGTH=1179 SoyBaseE_val: 2.00E-167ISS
GO:0006812GO-bp Annotation by Michelle Graham. GO Biological Process: cation transport SoyBaseN/AISS
GO:0006875GO-bp Annotation by Michelle Graham. GO Biological Process: cellular metal ion homeostasis SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0006891GO-bp Annotation by Michelle Graham. GO Biological Process: intra-Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009846GO-bp Annotation by Michelle Graham. GO Biological Process: pollen germination SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0010152GO-bp Annotation by Michelle Graham. GO Biological Process: pollen maturation SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0048867GO-bp Annotation by Michelle Graham. GO Biological Process: stem cell fate determination SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0015662GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0019829GO-mf Annotation by Michelle Graham. GO Molecular Function: cation-transporting ATPase activity SoyBaseN/AISS
GO:0046872GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion binding SoyBaseN/AISS
PTHR24093Panther FAMILY NOT NAMED JGI ISS
PTHR24093:SF48Panther SUBFAMILY NOT NAMED JGI ISS
PF00122PFAM E1-E2 ATPase JGI ISS
UniRef100_B9RHM6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cation-transporting atpase 13a1, putative n=1 Tax=Ricinus communis RepID=B9RHM6_RICCO SoyBaseE_val: 3.00E-180ISS
UniRef100_I1KBT2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KBT2_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g29100 not represented in the dataset

Glyma02g29100 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g29100.1   sequence type=CDS   gene model=Glyma02g29100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CAGGTTTTCTGTGTGGGTCTCTGGTGTTTGGATGAATATTGGTATTATAGTTTGTTCACTCTATTTATGCTGTTTATGTTTGAGTCAACCATGGCAAAAAGTCGGTTGAAAACTCTAACTGAGTTAAGACGTGTTAGAGTGGATAGTCAGATCCTAATGGTACATCGCTATGGCAAGTGGGTAAAACTCTCTGGTACAGAGCTTTTGCCTGAGGATGTTGTCTCCATAGGTCGCTCTTCTGGTCAGAATGGGGAGGAGAAGTCTGTACCAGCAGACATGCTTCTATTGGCTGGAAGTGTGATTGTGAATGAAGCTATTCTAACAGGCGAGTCTACCCCTCAATGGAAGATTTCAATTGCGGGTAGGGGGATGGAGGAGACATTGTCAGCAAGGCAAGATAAAAACCATGTGTTATTTGGTGGAACAAAAATATTGCAGCACACTCCAGATAAGAGTTTTCCTCTAAAAACACCTGATGGTGGCTGCTTGGTTGTTATCTTGAGAACGGGGTTTGAAACAAGTCAAGGAAAGTTGATGCGAACAATCTTATTCTCTACGGAAAGGGTGACTGCTAATAGCTGGGAAAGTGGATTCTTCATTTTATTCCTGGTTGTATTTGCTCTTATTGCTGCTGGTTATGTGCTTGTTAAGGGGCTAGAAGATCCCACAAGGAGCAAGTATAAACTTATACTAAGTTGTTCACTTATTGTTACTTCTGTGATTCCTCCTGAGTATCCAAGGTGCCAGTTTGCTACTACCCCCCAATTAAGTCAGGAGAGGGAGATTTGTTGGGATCCCTCCTTAATTCGAGAGAAGCTTGTGAAAGAATGTGGAAACCTCTGGAATATTCTAGAGATGTGTGGAACCTTCTGGAACCTTATGGAAGGATATGAAAAAGAATCATATGAAATTGGTTTTTATGTAACTTATTGTACATACCTTGCCCTACATGTTGATATATGCTGTTTTGACAAGACAGGGACACTTACTTCTGATGACATGGAATTTTCTGGAATTGTTGGGTTGAATGGAACTACAGATTTGGAATCTGATACGAGTAAAGTGCCTCTGCGAACAGTAGAAATCCTGGCTTCTTGCCATGCATTGGTATTTGTTGAGAATAAGCTG

>Glyma02g29100.1   sequence type=predicted peptide   gene model=Glyma02g29100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
QVFCVGLWCLDEYWYYSLFTLFMLFMFESTMAKSRLKTLTELRRVRVDSQILMVHRYGKWVKLSGTELLPEDVVSIGRSSGQNGEEKSVPADMLLLAGSVIVNEAILTGESTPQWKISIAGRGMEETLSARQDKNHVLFGGTKILQHTPDKSFPLKTPDGGCLVVILRTGFETSQGKLMRTILFSTERVTANSWESGFFILFLVVFALIAAGYVLVKGLEDPTRSKYKLILSCSLIVTSVIPPEYPRCQFATTPQLSQEREICWDPSLIREKLVKECGNLWNILEMCGTFWNLMEGYEKESYEIGFYVTYCTYLALHVDICCFDKTGTLTSDDMEFSGIVGLNGTTDLESDTSKVPLRTVEILASCHALVFVENKL







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo