SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g26530

Feature Type:gene_model
Chromosome:Gm02
Start:27432232
stop:27433888
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g26530
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G04040AT Annotation by Michelle Graham. TAIR10: Phosphofructokinase family protein | chr4:1939250-1942765 FORWARD LENGTH=569 SoyBaseE_val: 3.00E-59ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005945GO-cc Annotation by Michelle Graham. GO Cellular Compartment: 6-phosphofructokinase complex SoyBaseN/AISS
GO:0010318GO-cc Annotation by Michelle Graham. GO Cellular Compartment: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex SoyBaseN/AISS
GO:0003872GO-mf Annotation by Michelle Graham. GO Molecular Function: 6-phosphofructokinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0047334GO-mf Annotation by Michelle Graham. GO Molecular Function: diphosphate-fructose-6-phosphate 1-phosphotransferase activity SoyBaseN/AISS
PTHR13697Panther PHOSPHOFRUCTOKINASE JGI ISS
UniRef100_G7JKF2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pyrophosphate-fructose 6-phosphate 1-phosphotransferase subunit beta n=1 Tax=Medicago truncatula RepID=G7JKF2_MEDTR SoyBaseE_val: 7.00E-69ISS
UniRef100_I1KNH5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KNH5_SOYBN SoyBaseE_val: 7.00E-95ISS

Expression Patterns of Glyma02g26530
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma02g26530 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g170100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g26530
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g26530
>Glyma02g26530.1   sequence type=CDS   gene model=Glyma02g26530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACCGAAGGAGATTTTGCAATCAACGGTGGTTTCCCCGGCGCCAGAGTCACTCCTCCTTCCGTCACCGGTCGCTTCGCCGCCGTCTACAGCGAGGTCCAAAACAGTTGCATTGACCACGAACTCCCTCTCCCCTCCGTTCTCAAAAGCCCTTTCATCATTGTCGATAGTCCCCAAAGCTCTGCCGCCGGCAACCCTGAGGAGATCGCGAAGCCGTTCCCGAAACTGTTCGGGCAACCGTCCGCGGCTTTGGTGTCAAGTGATTCCCATGCGCCGCATGCAAATCGAAAGCTGAAGATTGGCGTGGTTCTGTCCGGTGTCCAGCCTCCCGACGGTCACAATGTTATTTTTGGAATCTTCGATTACCTACAAGACCTTGCAGAAGGAAGCACATTGTATGGTTTCAGGGGTGGTCCAGCTGGCATCATGAAGTGCAAATACATTGAACTTACCTCAGATTATATTTATCCTTCCAGAAATCAGACTATTGTGGCTAGGGAAACCCATTTCATCCCATTTCATCTTGTTATTAATACCATAGTTAGAACTTAG
Predicted protein sequences of Glyma02g26530
>Glyma02g26530.1   sequence type=predicted peptide   gene model=Glyma02g26530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTEGDFAINGGFPGARVTPPSVTGRFAAVYSEVQNSCIDHELPLPSVLKSPFIIVDSPQSSAAGNPEEIAKPFPKLFGQPSAALVSSDSHAPHANRKLKIGVVLSGVQPPDGHNVIFGIFDYLQDLAEGSTLYGFRGGPAGIMKCKYIELTSDYIYPSRNQTIVARETHFIPFHLVINTIVRT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo