SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g25127): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g25127): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g25127

Feature Type:gene_model
Chromosome:Gm02
Start:25943958
stop:25948877
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G50840AT Annotation by Michelle Graham. TAIR10: polymerase gamma 2 | chr1:18839277-18844313 FORWARD LENGTH=1050 SoyBaseE_val: 6.00E-83ISS
GO:0006139GO-bp Annotation by Michelle Graham. GO Biological Process: nucleobase-containing compound metabolic process SoyBaseN/AISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006264GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrial DNA replication SoyBaseN/AISS
GO:0033259GO-bp Annotation by Michelle Graham. GO Biological Process: plastid DNA replication SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003887GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA-directed DNA polymerase activity SoyBaseN/AISS
GO:0008408GO-mf Annotation by Michelle Graham. GO Molecular Function: 3'-5' exonuclease activity SoyBaseN/AISS
PTHR10133Panther DNA POLYMERASE I JGI ISS
PF00476PFAM DNA polymerase family A JGI ISS
UniRef100_G7K3G7UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA polymerase n=1 Tax=Medicago truncatula RepID=G7K3G7_MEDTR SoyBaseE_val: 5.00E-94ISS
UniRef100_UPI000233702EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233702E related cluster n=1 Tax=unknown RepID=UPI000233702E SoyBaseE_val: 3.00E-126ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g25127 not represented in the dataset

Glyma02g25127 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g313300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g25127.1   sequence type=CDS   gene model=Glyma02g25127   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTAACTTCTCAATTGCATATGGAAAGACGCCAGTTGGGCTTTCCAAGGATTGGAAGGTTACTGTGACAGAAGCTAGGAGAACAGTTGACCTTTGGTACAATGACAGAAAAGAAGTGCTGAAATGGCAAAAAGAACGTAAAAAAGAAGCTTGTGAATCTCAACGTGTTCACACATTGCTAGGGCGAGCCCGGCGGTTTCCTAAAATAGACCTAGCTAACAACTACCACAAAGGTCATATTGAGCGAGCTGCTATTAATACACCAGTGCAGGGTAGTGCAGCAGATGTTGCCATGTGCGCCATGTTAGAAATATCCAACAATATGAAGTTGAAGGAGCTTGGATGGAAGTTACTTCTACAGGTTCATGATGAAGTCATATTGGAAGGGCCAACAGAGTCTGCCGAGGTTGCAAAGGCTATAGTTGTTGAGTGCATGACGAAACCTTTCAATGGTGAGAATTTTCTTAGAGTCGGCCTCTCTGTCGATGCCAATTGTGCTCAAAACTGGTATGCTGCAAAATAG

>Glyma02g25127.1   sequence type=predicted peptide   gene model=Glyma02g25127   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLNFSIAYGKTPVGLSKDWKVTVTEARRTVDLWYNDRKEVLKWQKERKKEACESQRVHTLLGRARRFPKIDLANNYHKGHIERAAINTPVQGSAADVAMCAMLEISNNMKLKELGWKLLLQVHDEVILEGPTESAEVAKAIVVECMTKPFNGENFLRVGLSVDANCAQNWYAAK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo