SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g17420

Feature Type:gene_model
Chromosome:Gm02
Start:15696634
stop:15703861
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g17420
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G02460AT Annotation by Michelle Graham. TAIR10: DNA mismatch repair protein, putative | chr4:1076306-1080510 REVERSE LENGTH=923 SoyBaseE_val: 0ISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006200GO-bp Annotation by Michelle Graham. GO Biological Process: ATP catabolic process SoyBaseN/AISS
GO:0006261GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006298GO-bp Annotation by Michelle Graham. GO Biological Process: mismatch repair SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007140GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009691GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinin biosynthetic process SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009880GO-bp Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010050GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative phase change SoyBaseN/AISS
GO:0010072GO-bp Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048316GO-bp Annotation by Michelle Graham. GO Biological Process: seed development SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0032389GO-cc Annotation by Michelle Graham. GO Cellular Compartment: MutLalpha complex SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0030983GO-mf Annotation by Michelle Graham. GO Molecular Function: mismatched DNA binding SoyBaseN/AISS
KOG1978 KOG DNA mismatch repair protein - MLH2/PMS1/Pms2 family JGI ISS
PTHR10073Panther DNA MISMATCH REPAIR PROTEIN (MLH, PMS, MUTL) JGI ISS
PTHR10073:SF9Panther DNA MISMATCH REPAIR PROTEIN PMS2-RELATED JGI ISS
PF01119PFAM DNA mismatch repair protein, C-terminal domain JGI ISS
PF02518PFAM Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase JGI ISS
PF08676PFAM MutL C terminal dimerisation domain JGI ISS
UniRef100_G7IF83UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA mismatch repair protein n=1 Tax=Medicago truncatula RepID=G7IF83_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI0002336F63UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002336F63 related cluster n=1 Tax=unknown RepID=UPI0002336F63 SoyBaseE_val: 0ISS

Expression Patterns of Glyma02g17420
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g17420
ParalogEvidenceComments
Glyma10g02390 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g17420 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g155200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g17420
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g17420
>Glyma02g17420.1   sequence type=CDS   gene model=Glyma02g17420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTAGTCGAAGCTCAAATCATCAAGCCTATCGGCAAGGGCATCGTTCACAGAATCTGCGCCGGTCAAGTCATCCTCGACCTCTCTTCCGCCGTCAAGGAACTCGTCGAAAACAGCTTGGACGCCGGCGCCACCAGCATCGAAATCTCCCTCAAAGACTTCGGCGAACAGTGGTTTCAAGTCATCGACAACGGTTGCGGCATTTCCCCAAACAATTTCAAGGTTCTTGCGCTGAAGCATCATACGTCAAAGTTATCGGAATTTCACGATCTTCAGTCTCTGACGACTTTTGGATTCCGAGGGGAGGCGCTGAGTTCGCTCTGCGCGTTGGGGAACTTGACCGTTGAAACGAGAACGGCGAGCGAACCGGTCGCAACGCACTTGACTTTTGATAATTCCGGTGTTCTTGTGGCGGAAAGGAAAACGGCACGGCAAATTGGCACCACTGTTATGGTTAAGAAGTTGTTCTCCAATTTGCCTGTGAGAAGCAAGGAGTTTAGTCGTAACATACGTAGGGAATATGGCAAGTTGGTTTCTCTATTGAATGCTTATGCCCTTATAGCGAAAGGAGTTCGTTTTGTTTGCACCAATACAACTGGTAAAAATGTGAGGTCTGTTGTTCTTAAGACGCAAGGAAGTGGTTCTCTTAAGGATAACGTCATAACAGTGCTTGGCATGAACACTTTCAGCTGCTTAGAGCCCGTGACATTGTCTATATCTGATTCTTGTAAGGTTGAAGGATTTCTTTCCAAGTCTGGACAGGGTAATGGACGCAATTTGGGGGATAGACAGTATTTTTTTGTGAATGGTAGACCGGTAGATATGCCTAAAGTTAGCAAACTTGTGAATGAGTTGTACAAGGGTGCAAACTCCAAACAGTATCCCATTGCTATTTTGAATTTTACGGTTCCTACTAGAGTGTATGATGTCAATGTGACTCCCGACAAGAGGAAAATATTTTTTTCTGAAGAAAATGCCATATTGCAAGCCCTGAGAGAGGGATTGCAACAAATTTATTCTGCTAGTAATGTCTGTTACTCTGTTAATGAAGTTATGTTGCCTGCTGAAAAAGAAGAGTGTGTTGAGTTGTGTTCCTCTCATGGGAAGTCTCCTATTGTAAGGAAACTATATTCCCCAAATGCCAGTTGTCCTCAGAAAGAGCAATGTAGTGAAAGTAACAATGGTAGTGTTTCTTTAGATGAAATTGATACTGAGTGCAACAATGATACCATTTCTCAGGATGAGCATGAGGAGAAACATATTACTGATTCCAAAAATGCTTCTGAATCTATTAATGAATATCGGTACACACATATTGATGAAGGGTTAATTTGTGAAAATGATGGGAGTTTAATGAACCAGGAGTTTACACTCAGAGCACATAGCGCTTCAAAGGATGACGATAGTGGAAGTCGGTCAGCGTGTCCTAGTAGTATTATACCTGATCAAGCTACCCTTGTCTCAAGGACAGTTGAGAGTGGCAGCACTTCTAGTAAATATTCATTTAACCATTCAAGACATGTTCAGTCCACTCTTAACAACTTTGTTTCTGTAAATAAAAGAAATCGTGATAGTGTCATTAGAGCCTTATCTGAAGTGCCTGTTCTTAGAAATCAAGCTCCTCATTGTCAATTGAAGACTGCAAATACTGAAACACAGGACTTGATTACAAGATCATCACTTTGTTTTGACCAAAGTGATGAACCTGCTAGGGCGAGTGAGATTGAATCTTTGAAGCAACTTAATCCTGATAATGTCTTCTACAAAAATGAAAATGCAGTTTCTTTTAAGGGTGACTCCTCTGTTAGAGAACCTAAATCTAATATGGAATTAGATCTAAAGAATAATACACCTCTAGGGGATACAGCATCAATTACTCCTTCTAGCATTGATATGATCACTACGGATGTTTTGGCCTCAGACCCTCCATTACATTCATCACCTGTGTGGTTAAATTCTTGCAAGTCTTCCAGTAACAAGATATGTTCCAACATGCAATTTTCTTTTCAAGAGCTTAAGAAAAGGAGAGAGAAGAGGCTTTCTCTGTTGCAATCCAGTAAATTTGGATGTGGAAAAGCTAAAGTCAAAAGTCACTATTCGGCTGCAACTTTGGAGATTTTACAATCAGAAATTGGAGAGCAGAAAGAAAGGGCCTTGGCAGCAGCAGCTACCGAACTTGAAAGATTTTTCAAGAAGGAAGACTTCAGCAGAATGAAGGTGATTGGGCAATTCAATCTTGGATTTATCATTTGTAAATTGGATCAAGATTTATTCATTGTGGACCAGCATGCTGCTGATGAGAAGTATAATTTTGAGCGTTTATCACAGTCAACCATCTTGAACCAACAACCTCTTCTTAGGCCAATAAAATTGGAGTTATCCCCTGAAGAAGAAATAGTTGCTTCGATGCACATGGACATAATCAGGAAGAATGGATTTACCTTGGAAGAGGATCCAAATGCACCGCCTGGATGCCGTTTTAAATTAAAGTCTGTCCCCTTCAGTAAAAACACTATGTTTGGAATTGAAGATGTTAAGGAGCTGATCTCTATCTTGTCTGATGGTGATGGTCATGTGGAATGTTCCATAGTTGGTAGCTATAAACTGGACACCTCAGATTCTGTTTGCCCTTCAAGAGTTCGTGCAATGTTGGCATCACGAGCATGTCGATCATCTATTATGGTTGGTGATGCACTTGGAAGAAATGAAATGCAGAAGATACTTGAGCATATGGCTGAGCTGAAATCCCCATGGAATTGTCCCCATGGCAGACCAACCATGCGCCATTTAGTCGACTTAACAAAAATTCACAAGAGCTATGAACTTACAATGCAGATGTAA
Predicted protein sequences of Glyma02g17420
>Glyma02g17420.1   sequence type=predicted peptide   gene model=Glyma02g17420   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVVEAQIIKPIGKGIVHRICAGQVILDLSSAVKELVENSLDAGATSIEISLKDFGEQWFQVIDNGCGISPNNFKVLALKHHTSKLSEFHDLQSLTTFGFRGEALSSLCALGNLTVETRTASEPVATHLTFDNSGVLVAERKTARQIGTTVMVKKLFSNLPVRSKEFSRNIRREYGKLVSLLNAYALIAKGVRFVCTNTTGKNVRSVVLKTQGSGSLKDNVITVLGMNTFSCLEPVTLSISDSCKVEGFLSKSGQGNGRNLGDRQYFFVNGRPVDMPKVSKLVNELYKGANSKQYPIAILNFTVPTRVYDVNVTPDKRKIFFSEENAILQALREGLQQIYSASNVCYSVNEVMLPAEKEECVELCSSHGKSPIVRKLYSPNASCPQKEQCSESNNGSVSLDEIDTECNNDTISQDEHEEKHITDSKNASESINEYRYTHIDEGLICENDGSLMNQEFTLRAHSASKDDDSGSRSACPSSIIPDQATLVSRTVESGSTSSKYSFNHSRHVQSTLNNFVSVNKRNRDSVIRALSEVPVLRNQAPHCQLKTANTETQDLITRSSLCFDQSDEPARASEIESLKQLNPDNVFYKNENAVSFKGDSSVREPKSNMELDLKNNTPLGDTASITPSSIDMITTDVLASDPPLHSSPVWLNSCKSSSNKICSNMQFSFQELKKRREKRLSLLQSSKFGCGKAKVKSHYSAATLEILQSEIGEQKERALAAAATELERFFKKEDFSRMKVIGQFNLGFIICKLDQDLFIVDQHAADEKYNFERLSQSTILNQQPLLRPIKLELSPEEEIVASMHMDIIRKNGFTLEEDPNAPPGCRFKLKSVPFSKNTMFGIEDVKELISILSDGDGHVECSIVGSYKLDTSDSVCPSRVRAMLASRACRSSIMVGDALGRNEMQKILEHMAELKSPWNCPHGRPTMRHLVDLTKIHKSYELTMQM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo