SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g16620

Feature Type:gene_model
Chromosome:Gm02
Start:14997412
stop:15000167
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g16620
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G63140AT Annotation by Michelle Graham. TAIR10: chloroplast stem-loop binding protein of 41 kDa | chr3:23327006-23328620 REVERSE LENGTH=406 SoyBaseE_val: 0ISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0032544GO-bp Annotation by Michelle Graham. GO Biological Process: plastid translation SoyBaseN/AISS
GO:0045727GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of translation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003729GO-mf Annotation by Michelle Graham. GO Molecular Function: mRNA binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008266GO-mf Annotation by Michelle Graham. GO Molecular Function: poly(U) RNA binding SoyBaseN/AISS
PTHR10366Panther NAD DEPENDENT EPIMERASE/DEHYDRATASE JGI ISS
PTHR10366:SF119Panther SUBFAMILY NOT NAMED JGI ISS
PF01370PFAM NAD dependent epimerase/dehydratase family JGI ISS
UniRef100_G7IED1UniRef Annotation by Michelle Graham. Most informative UniRef hit: MRNA-binding protein n=1 Tax=Medicago truncatula RepID=G7IED1_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1JFA6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JFA6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma02g16620
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g16620
ParalogEvidenceComments
Glyma10g03200 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g16620 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g147300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g16620
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g16620
>Glyma02g16620.1   sequence type=CDS   gene model=Glyma02g16620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCACCATTGCTTCTTCCTCATCCACTGTGCTCTTCTCTGCATCCTCTTCCAACCTCCTCCCATTTTCACACCCTTCTACTTCGCGCCTTTCTTTCTCTTCTTCCCTTCACTCCTCATCCTTCTCTCTATCAATTTCTCCTTCCTTTTTGTCATACTATTCTTCAAGTTCTACACACTTTGCCACTCATGCTGCCTTCAGCATCAGTGCCAGTGCCGCCGAGAAGAAGAAGGTGCTCATCGTGAATACCAACAGCGGCGGGCATGCCATCATTGGCTTTTACTTTGCCAAAGAGCTTCTTGGTGCTGGCCACTCAGTCACCATACTCACTGTTGGTGAAGAAGGCTCCGACAAGATGAAGAAACCTCCTTTCAACAGATTCTCAGAAATTGTGAGTGCCGGAGGGCGCACGGTGTGGGGAAATCCTGCAGAAGTAGGGAGTGTTGTAGGAGGGGAAGTGTTTGATGTGGTCTTGGACAACAATGGCAAGGATCTTGAGACTGTGAGGCCGGTGATTGATTGGGCCAAGAGTTCAGGTGTCAAGCAATTCCTGTTCGTCAGCAGTGCTGGAATCTACAAACCAACAGATGAACCTCCACATGTTGAAGGCGATGTTGTTAAAGCAGATGCTGGTCATGTTGAAGTGGAGAAATACATTGAAGAAACCTTTGGAAGTTGGGCAGTGTTCCGGCCACAGTACATGATTGGGTCTGGCAACAATAAAGACTGTGAGGAGTGGTTTTTTGACAGGATTGTTCGGGACAGACCTGTGCCAATTCCTGGCTCGGGACTGCAACTCAGTAACATAGCTCATGTTAGGGACTTGTCCTCAATGCTTACTCTAGCTGTTGAGAATCCAGAAGCTGCAAATCAGACCATTTTCAACTGCGTAAGTGACCGTGCAGTGACTCTAGACGGAATAGCCAAACTATGTGCTCAAGCTGCAGGGCGCCCCGTTAACATTTTGCATTATGATCCAAAAGCTGTTGGAGTTGATGCAAAGAAGGCTTTCCCTTTCCGCACCTATCACTTCTATGCAGAACCTAGAGCAGCCAAAGCTAAATTGGGATGGCAATCAACCACAAACCTCCCTGAAGACCTAAAAGAACGGTTTGAGGAGTACGTAAAGATTGGGAGAGATAAGAAGTCCATCCAGTTCGAGCTAGATGATAAGATATTGGAGGCGTTGAAAGTTCCGGTGACTGTGTGA
Predicted protein sequences of Glyma02g16620
>Glyma02g16620.1   sequence type=predicted peptide   gene model=Glyma02g16620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATIASSSSTVLFSASSSNLLPFSHPSTSRLSFSSSLHSSSFSLSISPSFLSYYSSSSTHFATHAAFSISASAAEKKKVLIVNTNSGGHAIIGFYFAKELLGAGHSVTILTVGEEGSDKMKKPPFNRFSEIVSAGGRTVWGNPAEVGSVVGGEVFDVVLDNNGKDLETVRPVIDWAKSSGVKQFLFVSSAGIYKPTDEPPHVEGDVVKADAGHVEVEKYIEETFGSWAVFRPQYMIGSGNNKDCEEWFFDRIVRDRPVPIPGSGLQLSNIAHVRDLSSMLTLAVENPEAANQTIFNCVSDRAVTLDGIAKLCAQAAGRPVNILHYDPKAVGVDAKKAFPFRTYHFYAEPRAAKAKLGWQSTTNLPEDLKERFEEYVKIGRDKKSIQFELDDKILEALKVPVTV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo