Report for Sequence Feature Glyma02g13820
Feature Type: gene_model
Chromosome: Gm02
Start: 12135439
stop: 12137499
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma02g13820
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G69940 AT
Annotation by Michelle Graham. TAIR10: Pectin lyase-like superfamily protein | chr1:26343549-26344971 REVERSE LENGTH=361
SoyBase E_val: 2.00E-150 ISS
GO:0009860 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen tube growth
SoyBase N/A ISS
GO:0042545 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell wall modification
SoyBase N/A ISS
GO:0005576 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: extracellular region
SoyBase N/A ISS
GO:0005618 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cell wall
SoyBase N/A ISS
GO:0005783 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum
SoyBase N/A ISS
GO:0005794 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus
SoyBase N/A ISS
GO:0009505 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall
SoyBase N/A ISS
GO:0090406 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: pollen tube
SoyBase N/A ISS
GO:0030599 GO-mf
Annotation by Michelle Graham. GO Molecular Function: pectinesterase activity
SoyBase N/A ISS
PTHR22931 Panther
PHOSPHOENOLPYRUVATE DIKINASE-RELATED
JGI ISS
PTHR22931:SF5 Panther
METHYLESTERASE INHIBITOR-RELATED
JGI ISS
PF01095 PFAM
Pectinesterase
JGI ISS
UniRef100_B9HAS7 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Pectinesterase n=1 Tax=Populus trichocarpa RepID=B9HAS7_POPTR
SoyBase E_val: 4.00E-162 ISS
UniRef100_I1JEL9 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JEL9_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma02g13820
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma02g13820
Paralog Evidence Comments
Glyma01g09350 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma02g13820 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.02g124800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma02g13820
Coding sequences of Glyma02g13820
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma02g13820.1 sequence type=CDS gene model=Glyma02g13820 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCCTCAAAAACTATATGCACTACCATTCAGGTGACTCTCATAGTAGCTTTTCTAACAACCCAGGTTGTTTTCTCTGATGACACTGTGCCAATTCCTGCTCACAAGGCACAATTGGGCACATGGTTTAGTACTAATGTAGGGCCTTTAGATCAAAGAAAAAGCACTATGGACCCTGCATTGGTGGCAGCTGAAGAAGGTGCTAAGGTTGTGAAGGTAATGCAAGATGGAAGTGGGGAATTCAAGACCATCACTGATGCCATTAACAGCATACCTAGTGGGAACACTAAACGTGTAATTGTGTACATTGGAGCTGGAAATTATAATGAGAAAATAAAAATTGAGAAGACAAAGCCTTTCATCACCTTGTATGGCGTACCAGAGAAAATGCCAAACTTGACATTCGGGGGAACTGCACTAAAATATGGCACTGTTGATAGTGCTACATTGATTGTTGAATCAGATTACTTTGTGGCAGCTAACATCATAATCTCGAACTCTGCACCAAGACCTGATGGAAAAATACAAGGAGGTCAAGCAGTGGCATTGCGAATTTCTGGTGACAAAGCAGCATTTTATAATTGCAAGTTCTTTGGATTCCAGGACACAATTTGCGATGATAGGAATAGACATTTTTTCAAAGACTGCTTAATTCAAGGCACCATGGATTATATTTTTGGAAGTGGGAAGTCACTATATCTGAGTACTGAACTAAGAACGCTTGGCGACACTGGGATTACTGTTATAGTGGCGCAAGCAAGAAAAAGTCCTACAGAGGACAATGCCTACTCATTTGTACATTGTGACGTTACTGGAACTGGGAATGGCACTTTCTTGGGCAGAGCATGGATGCCTCATCCTAGAGTGGTCTTTGCATACAGCACCATGAGTGCCGTTGTGAAAAAAGAAGGGTGGAGTAACAACAATCATCCTGAACATGACAAAAATGTTCGTTTTGGAGAGTATCAGAATACGGGACCTGGTGCAGACCCCAAAGGACGTGCTGCTATAACTACGCAACTAAATGAAATGCAGGTCAAACCTTACATAACACTTGGGATGATTGAAGGCTCCAAATGGCTACTTCCTCCTCCAACTCCCAAAGTCTAA
Predicted protein sequences of Glyma02g13820
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma02g13820.1 sequence type=predicted peptide gene model=Glyma02g13820 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MASKTICTTIQVTLIVAFLTTQVVFSDDTVPIPAHKAQLGTWFSTNVGPLDQRKSTMDPALVAAEEGAKVVKVMQDGSGEFKTITDAINSIPSGNTKRVIVYIGAGNYNEKIKIEKTKPFITLYGVPEKMPNLTFGGTALKYGTVDSATLIVESDYFVAANIIISNSAPRPDGKIQGGQAVALRISGDKAAFYNCKFFGFQDTICDDRNRHFFKDCLIQGTMDYIFGSGKSLYLSTELRTLGDTGITVIVAQARKSPTEDNAYSFVHCDVTGTGNGTFLGRAWMPHPRVVFAYSTMSAVVKKEGWSNNNHPEHDKNVRFGEYQNTGPGADPKGRAAITTQLNEMQVKPYITLGMIEGSKWLLPPPTPKV*