SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g12690): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g12690): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g12690

Feature Type:gene_model
Chromosome:Gm02
Start:10974671
stop:10978515
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G03430AT Annotation by Michelle Graham. TAIR10: Ankyrin repeat family protein | chr2:1036192-1037536 REVERSE LENGTH=240 SoyBaseE_val: 5.00E-120ISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006259GO-bp Annotation by Michelle Graham. GO Biological Process: DNA metabolic process SoyBaseN/AISS
GO:0007059GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome segregation SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007140GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0032504GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0043248GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome assembly SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0051510GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of unidimensional cell growth SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
KOG4412 KOG 26S proteasome regulatory complex, subunit PSMD10 JGI ISS
PTHR24199Panther FAMILY NOT NAMED JGI ISS
PTHR24199:SF294Panther JGI ISS
PF00023PFAM Ankyrin repeat JGI ISS
UniRef100_G7JXW1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ankyrin repeat domain-containing protein n=1 Tax=Medicago truncatula RepID=G7JXW1_MEDTR SoyBaseE_val: 3.00E-131ISS
UniRef100_I1JEB4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JEB4_SOYBN SoyBaseE_val: 2.00E-173ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g12690 not represented in the dataset

Glyma02g12690 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g06750 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g113900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g12690.1   sequence type=CDS   gene model=Glyma02g12690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGATGGAAGTAGACATCGAGAAGAAGCAACAAGACGTGGTGAAAGAGAAAGACTTGTTCAAAGCTGCAGAAGAGGGCGAGGCATCAACGTTCGAAGCTCTCTCTTCTGAAATCCTCTCCAAAGCCCTCTCTCTCAGAAACGAAGACGCTCGTTCCCTTCTCCACGTCGCAGCTTCTTCCGGTCACTCCCAGGTAGTGAAGATAGTGTTGTCTTGTGATGCATCTGCTGGTGTGGTGAATTGTGCTGATGAGGAAGGGTGGGCGCCGCTTCACTCTGCAGCCAGCATTGGGAGTGTGGAGATAGTGGAGACTCTATTGAGCAAAGGAGCTGATGTTAATCTGAAAAATAATGGGGGTCGTGCTGCTCTACACTATGCGGCCAGCAAAGGTTGGGTGAAGATTGCTGAAATGCTCATCTCCCATGATGCCAAGATTAATATAAAGGATAAGGTTGGTTGCACTCCATTGCATCGGGCAGCTAGCACTGGGAAATCTGAGCTGTGTGAACTTTTGATTGAAGAAGGAGCAGAGGTTGATGCTGTTGATAGAGCTGGTCAAACTCCTCTAATGAATGCTGTGATTTGCTATAACAAAGAGGTAGCCCTTCTTCTGATAAGACATGGAGCAGATGTGGATGTGGAGGACAAGGAAGGGTACACGGTGCTTGGTCGAGCCACGCATGAGTTTAGACCAATATTAATTGATGCTGCCAAGGCCATGCTTGAGTGA

>Glyma02g12690.1   sequence type=predicted peptide   gene model=Glyma02g12690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEMEVDIEKKQQDVVKEKDLFKAAEEGEASTFEALSSEILSKALSLRNEDARSLLHVAASSGHSQVVKIVLSCDASAGVVNCADEEGWAPLHSAASIGSVEIVETLLSKGADVNLKNNGGRAALHYAASKGWVKIAEMLISHDAKINIKDKVGCTPLHRAASTGKSELCELLIEEGAEVDAVDRAGQTPLMNAVICYNKEVALLLIRHGADVDVEDKEGYTVLGRATHEFRPILIDAAKAMLE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo