SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma02g12330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma02g12330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma02g12330

Feature Type:gene_model
Chromosome:Gm02
Start:10595829
stop:10599649
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52220AT Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Kinase phosphorylation domain (InterPro:IPR019315); Has 8882 Blast hits to 4920 proteins in 346 species: Archae - 10; Bacteria - 184; Metazoa - 3955; Fungi - 1221; Plants - 712; Viruses - 24; Other Eukaryotes - 2776 (source: NCBI BLink). | chr3:19369580-19370980 REVERSE LENGTH=237 SoyBaseE_val: 8.00E-93ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG4520 KOG Predicted coiled-coil protein JGI ISS
PTHR14580Panther UNCHARACTERIZED JGI ISS
PF10159PFAM Kinase phosphorylation protein JGI ISS
UniRef100_G7JWG8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Multiple myeloma tumor-associated protein-like protein n=1 Tax=Medicago truncatula RepID=G7JWG8_MEDTR SoyBaseE_val: 6.00E-100ISS
UniRef100_UPI0001B64297UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001B64297 related cluster n=1 Tax=unknown RepID=UPI0001B64297 SoyBaseE_val: 5.00E-167ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma02g12330 not represented in the dataset

Glyma02g12330 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma01g06270 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g110700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma02g12330.1   sequence type=CDS   gene model=Glyma02g12330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTATCATCCAACAAGAGGTGGCGTTCGTGGTGGTCGAGATCAATTCACTTGGGAGGATGTGAAAGCTGATAAGCATAGGGAGAACTATCTTGGTCACAGTATCAAGGCTCCTGTTGGAAGATGGCAGAAAGGGAAAGATCTTTTCTGGTATACCAGGGATAAAAAGTCCCAAAATGCAGAAATGGAGGCTGCAAAAGAAGAGATAAAAAGAATTAAGGAAGAAGAGGAGCAGGCAATGAGGGAAGCTCTTGGCTTAGCTCCCAAGCGTTCTAACCGTCCTCAAGGTAACCGTCTTGATAAACATGAGTTTTCAGAACTGGTAAAGAGGGGGTCTACAGCAGAGGACGTAGGTGCAGGTCATGCTGAAGCAGCAAGGGTTCAAGGTCTTGGTTTTGCAAGAGAACCACGCCCTTGGGAAGAACCTGGTTCTTCAAAGCCTTCACTCGGTGATACACCAGCTGAGGAGGAAAATGTATCTTTGCCAAGTCAACCAGCAATGAAGACTGCAGATGATTCAGAAGATGAAAGTAGAAGAAAGAGAAGACGTGAAGAGAGGAAGGAGGAGAAACGTGAAAAGCGTGAGAAGCATCATTCTCGCGAGGATAGGAAGCAAGAGAAACGAGAGAAACATGAGAGGGGGCATTCTCGTGATTCAGATGGCAGGAAGAGACACAAGAAAGATAAGGAGAGGAGAAGACATGATTCTGATTGA

>Glyma02g12330.1   sequence type=predicted peptide   gene model=Glyma02g12330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYHPTRGGVRGGRDQFTWEDVKADKHRENYLGHSIKAPVGRWQKGKDLFWYTRDKKSQNAEMEAAKEEIKRIKEEEEQAMREALGLAPKRSNRPQGNRLDKHEFSELVKRGSTAEDVGAGHAEAARVQGLGFAREPRPWEEPGSSKPSLGDTPAEEENVSLPSQPAMKTADDSEDESRRKRRREERKEEKREKREKHHSREDRKQEKREKHERGHSRDSDGRKRHKKDKERRRHDSD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo